Transcript asmbl_38586

Sequence
Transcript Sequence for observation asmbl_38586 of TGE0005060:
CGGCCCGGTGCCCCGGATGTAGGCTTGGCGAAAGCATCGCTTCTTCCCCCGCCTGCCTTGGACTCGTAGCTTGGTGAAGGCCCCTCTGTCCAGTTATGTCAAAGAGGAAAGTGACCTTCCAAGGCTTGGGAAATGAGGATGATGAAGACGAAATCAGTGTCCCCAAGAAGAAGCTGGTGGACTCTGTGGCTGGGGCAGGAGGTCCTGGGAGCCGCTTTAAAGGCAAGCACTCTTTGGACAGCGATGAGGAGGATGATGATGATGAGGGGTCCAGCAAATATGACATCCTGGCCTCAGAGGATGTAGAAGGTCAGGAAGCAGCCACACTCCCCAGCGAGGGAGGGGTACGGATCACACCCTTCAACCTACAGGAAGAGATGGAGGAAGGCCACTTTGATGCTGATGGCAACTACTTCTTGAACCGGGAGGCTCAGATACGAGACAGCTGGCTAGACAACATTGACTGGGTTAAGATCAGGGAGCGGCCACCTGATCAGCACCCACCATCAGACTCAGAGGAGGAGGACAGCCTGGGCCAGACACCAATGAGTGCCCAAGCCCTCCTGGAGGGCCTTCTGGAGCTGCTGTTGCCGAGAGAGACAGTGGCTGGGGCGCTGAGGCGCCTAGGGGCCAGAGGAGGAGGCAAAGATGGCAGCAAGGGGCCTAGGCGGCCTAGTTCCCCCCAGCGCTTGGACCGGCTCTCCGGGTTGGCTGACCAAATGGTGGCCCGGGGCAACCTTGGTGTATATCAGGAGACAAGGGAACGGTTGGCCATGCGGCTGAAGGGGTTGGGGTGCCGGACCCAGGGACACCCTGACCCCAAGCCCCCACCTTCTCTGGACATGTTTGCTGAGGAAGTGGCAGAGGGGGAGCTGGAGACCCCAACCCCTGCCCAGAGAGAAGCAGATTCGCCAGGAGATGGTTTGCTGGATGTGATGTGGGAGTATAAGTGGGAGAACACAGGGGATGCTGAGCTGTACGGGCCCTTTACCAGCACCCAGATGCAGACCTGGGTGAATGAAGGCTACTTCCCGGATGGTGTTTATTGTCGGAAGCTGGACCCCCCTGGTGGACAGTTCTACAACTCCAAACGTATTGACTTTGACCTCTACACCTGAGCCTACTGAGGGCTCACTTAGGTGGCCCCTTCTTTCCTGGACTCTGTGAAGGAGGCTCCAGCTGCCTCAGGCAGTGAGGATATTGGGGGCAACTTTTCAGTCAATTTTCCTTTCCCAATAAAAGCCTTTAGTTGTGTGTTAGGGCCTTGGCTTTGCTGATGGCCAGAAGCCAGAGACCACAGCCCCTTTGGACTTGCCTTGGTCTTATAGTGTTTCCTCATGAAGTTCCTCTTTGACAGTTCTGGTCCCTCAAACCATCTCCTGTTTACTGTTCATAAGGGCAGAGCCAGGGCTGTCAGGTGAACAGTGGCCTCCCTTTTTGGATGCAGATCACCATCTAAAAATCTCTTTACTCGTGTGGCATTCTTTGGTATCCTCTGGGCTTCCTGTTTTGCTTTTCTTCGGTCTTTGGTCTTTAGGACCTCAGAGTCTCTCCTTGCAAACAGTGCAGGGTAGAGCCCTAGCAGCGGAGATTTTAGGTCTGATGGGCTGGGGCATCTGTTGGTTTTGAGTAGGAAGCATGGTACTCACTGGCTTCTCATTTTCTCAGGCTCCTTAGGTGAAGTACAGACTCAGTATTGACTCTTGAAGGACTCCAAGGCCACCTGGGCAAACCATCCATAGAATAGGCACAGAGAGGGACAGCACCTCACTGAAGGTTACACAGTTAATCAGAGGACTGGCCCAGACCCAATGGGCTCCCTTCCCAGACCTTTCTTGGTACTAGGTCTTTTCTACCTGGCCTTGAAGCCCTGAGCTTACATTTCCTGAGCTTCCAAAGTGTGCCTGGCACTGAACTAGTGCCTTGAGGAAACTGAGATAACTGGGCTGGTCCCCTTTCAGGAGTTCACAGTCAGGAGTGTAGGTGAAGAGGGAGATAGACAAGTATAATTGTACAGTCTGGACCTACCACTACCACCCTCCCAGCCCATCAGTATGGCTTAAAGCCTCTCCTCACTTGACCAGTTTAGATTTTTCCCTCCACTTTTTCAACTTGGCTGTCCATTGGAATCTCATAGAGAGCTGTTAAATCACTCCTCAGAGACTCCGAATGAGTTGGTTTAGGTAGTGGCCTGGCAGTTGGGTTTTTAAAAAGTTCTCAGGTCTTTCTAATGTGTGGCCAGGTGGAGAGCCATTGGATCTGACTCCCATGACAAGTTATACCTGGGGAGAGGGGCTGGTTCCTGGACTCCGCCGTGGTAGAGCTGAGCATGTGTCTGGCCAGGGCTCTGGTTGATTCTGTTAGTTACAGGAGAGCTGAGCACCAGAGCCGTGGATGCATGGGAGCTCCAGGGTGGAAGGAACCAGGACTGGAACTAGGAAAGACTTGGG