Transcript asmbl_38549

Sequence
Transcript Sequence for observation asmbl_38549 of TGE0005055:
CCTGTGCCGCCCCCTCGGGAGCTGAATAGGCCGCGTTCCGCTTGGAACGCGCCGCAGAACCGGGGTGCTGGTGACGACCGCTGCGTTCGCTCCCTCAGTCCACTCGCCAGCCCGCTGCCCTCCACCGCTGCACCGGGCAAACCAGCCCCTCTACTCTGCCAGGCAAGGTGACCCCATGGCAAGGCGCAAGCCAGAAGGGTCCAGCTTCTACATGAGCCATCTGTCCATGGCTCTGGCCTATTCCTTTACCCCAGATGCCAGTATGCAACCCCACCCTCAGCTGGGCAACACCCAGCAACAAACAGAGTTAGGAAAGGTACAAGAGGCAGGCCTAGTTTAGGGAAGTCGGGTGTAGGGGAGAGCTGGGGACAGGAAATGATCTAAGACCTACTGGGTGTGGGGCAGAGGAGGTAGGGAACATTTGCCCTGACCTCCAGGTAAGGGGCCCTGCTCACTGGGAGACCACAGAAAGACCTAGCAAACTGGTCCTCTCCGCTCTGTTTCCTTTGCCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGGA