Transcript asmbl_38544

Sequence
Transcript Sequence for observation asmbl_38544 of TGE0009200:
GAAAAAAGGTCAGGAATTGGGCTGGGCTGGCCTGGCTGTGGTGACCCTGGTCTTCTGTCTCTAGAGAGATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTGGGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGATCGTGGTTTCTACAGCGTTGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGACCGAATCACCCTGATACGGGGCAACCATGAGAGCCGTCAGATCACCCAGGTCTACGGCTTCTATGATGAGTGCCTGCGCAAATATGGCTCAGTGACCGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATTGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCTTCCATCCAGACCCTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTGCCTCACGACGGGCCCATGTGTGACCTGCTCTGGTCTGACCCTGAAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATGGTA