Transcript asmbl_38542

Sequence
Transcript Sequence for observation asmbl_38542 of TGE0009200:
CAAGGAGCTGTTCAGAGTGAGTGTGGGTAAACATTGGGGAAGGTGACCAGGGGGGTGACTGGAAGACCCTTTTGAGAGAGAAAGCTTTGAATATGGTGAGTGGAGTAGGGGCATAAGGCCTCTAGTTAGGTGTTTGATGGGCCTTTTGTGAAAGAAGGGCTTCAACTTGACTGGAAATGGGCCACCACAGTGGGTAGGGAACAGTTTAGGACCAAGCAGAAGTTTCTCCCCCCAGGTGGGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGATCGTGGTTTCTACAGCGTTGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGACCGAATCACCCTGATACGGGGCAACCATGAGAGCCGTCAGATCACCCAGGTCTACGGCTTCTATGATGAGTGCCTGCGCAAATATGGCTCAGTGACCGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATTGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCTTCCATCCAGACCCTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTGCCTCACGACGGGCCCATGTGTGACCTGCTCTGGTCTGACCCTGAAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATGGTA