Transcript asmbl_37542

Sequence
Transcript Sequence for observation asmbl_37542 of TGE0005027:
CACAGCCAGGATGGGTTGGCAACTGGGTTGCGAGTTCTTTCCAAACTACAACTCCCAGGAGGCACCGGATACCCACAGCCCACGCGACGTCACAGCGGCAGAGGGTGAGGGCAGCTCGGCTAGCCCCGCCCGTCGACTGTTGGGCCTTTACGCTCGGACCCCGGCCCTGGCTCGGGTTCCGCGATGGGAGCTGCTCCTCGGGGGCTGAGCTTGTCAGCATCCTCCTACGGCCCTCGCCTCTGAAGTCAGAGAAGAGCCCCTACACCCACATCCCTCTTGTCCCGTTTTGGGGTCGCCTCCGTCTACCCGGTGCTTAGCCCTAGTGGCCTCCTTAGTCCGACAGAGGAGCAGGACGATGATACTGGCATCTGTGCTGGGGAGTGGCCCCCGGGGCGGGCCTCTGCTCCGTCCCTACCTGGGGCCTGCACTCTTGCTCCGGGCACGCTCCACATCAGCCACCGACACACATCATGTGGAGATGGCGCGGGAGCGCTCCAAGACCGTCACCTCCTTTTATAACCAGTCAGCCATCGACGTGGCAGCTGAGAAGCCCTCAGTCCGCCTCACTCCAACCATGATGCTCTATTCTGGCCGATCTCAAGACGGCAGCCACCTTCTGAAAAGTGCCCGGTACTTGCAGCAAGAGTTGCCAGTGAGGATTGCTCACCGCATCAAGGACTTCCGCAGCCTTCCTTTCATCATTGGCTGCAACCCCACCATACTGCACGTGCATGAGCTGTACATCTGTGCCTTCCAGAAGCTGACAGACTTCCCTTCGATCAAAGACCAGGCGGATGATGCCCAATACTGTCAGCTGGTGCGTCAGCTGCTGGACGACCACAAAGATGTGGTGACCCTCTTAGCTGAGGGCCTACGTGAGAGCCGGAAGCACATACAGGATGAGAAGCTTGTCCGCTACTTCTTGGACAAGACACTAACTTCAAGGCTTGGGATCCGCATGTTGGCCACACATCATCTGGCACTGCATGAGGACAAGTCTGACTTTGTTGGCATCATCTGCGCTCGTCTCTCACCAAAGAAGATTATTGAAAAGTGGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCCCCCCGTGTCCGCATCAATGGACATGTAGCTGCTCGATTCCCCTTCATTCCAATGCCACTGGACTACATCCTGCCCGAGTTGCTCAAGAATGCCATGAGAGCCACGATGGAGAGTCACCTAGACACTCCCTACAATGTACCAGATGTGGTTATCACCATCGCCAACAATGATATCGATCTTGTCATCAGGATTTCAGACCGGGGTGGGGGAATTGCTCACAAAGACCTGGATCGTGTTATGGACTACCACTTCACTACAGCTGAGTCCAGCACCCAGGACCCCCGGATCAACCCACTCTTTGGCCACTTGGACATGCACAATGGTGGCCAGTCAGGACCCATGCATGGCTTTGGCTTCGGGCTGCCCACCTCACGGGCCTATGCGGAGTACCTTGGTGGTTCCCTTCAGCTGCAGTCCCTGCAGGGCATTGGCACAGATGTCTACCTGCGACTCCGTCACATCGATGGCCGGGAAGAAAGCTTCCGCATCTGATCCCACAGTCCTTGACCCTGCCCATCCCAGGCCACACACCCTGCTCCACACACTGCTGCATCTTGGGTCCTAGGACCCCAAATGGATGGACTTACATGGAGCCAGCGCCACCTCTCAACGGGGTCCACTGCTTACCTGCCTCCAGGCCTTGGTGGGGAAGTGGGGACACTTGAGGTCTCCAGCACCAGCTCCTTCCTCGTTCCTGAGGAACCCCATTTTGACCTGCTGTTTGTTAATTAAAGTTCACATTTTGAATTCT