Transcript asmbl_37434

Sequence
Transcript Sequence for observation asmbl_37434 of TGE0005017:
TGGAAGGGGGAGCTCTACCCTCAGAACATGAGGGGTAATATTTGCGTGGCTCACAAAGACCAGTGAGTACATCATCTGCATTTCCCACAGCTCACAGAGGAGGGCTCTAACATCAGTCCCGGTCCAGCCTTTTCTGTCCCTCAGAGAACACTTTTCATTATGGCCAAGTGTAATTTTCCTCAGTATTTTCTTGGAAATGTTATTGAGGGATGGGGGTCCTTTTACAAATTTTGGAAATAAATAAGATGAGAAGACCATGCTTCTGAATGATCATTTAGTTTAAGAAAACCCCTTGATTTAATGTGATTATGGATATGTTGGCTGGAGTGTAGTTTAAGATCTTCCCACTGAACCTACAGGCTTTAAGAAACCAACCCAGGAGTGTATTTTCCTGTCGAACAAATGGGTTCCGAGACCATACCTGTAATTGATCCTATCTCTCTGCTTCTCCTGAGCTAGGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAATAAATCTGACAAGACTGCCTCCTGACGACTGC