Transcript asmbl_37360

Sequence
Transcript Sequence for observation asmbl_37360 of TGE0005013:
CTCGCTCCCAGACGCACTTGTTCTTCTCCGAGAAAACACCAAATGGCGGATGACGCCGGTGCTGCGGGAGGGCCCGGAGGCCCCGGGGGCCCTGGGATTGGAGGCCGCGGCGGCTTCCGTGGAGGATTCGGCAGCGGCATCCGGGGTCGAGGTCGTGGCCGGGGTCGCGGCCGGGGCCGAGGCCGCGGAGCTCGCGGAGGCAAAGCTGAGGATAAGGAGTGGATTCCCGTCACTAAGTTGGGCCGCTTGGTCAAGGACATGAAGATCAAGTCTCTGGAGGAGATCTATCTCTTCTCCCTGCCAATCAAGGAATCTGAGATCATTGACTTTTTCTTGGGAGCATCTCTCAAAGACGAGGTTTTGAAGATTATGCCCGTGCAAAAGCAGACCCGTGCTGGTCAGAGGACCCGGTTCAAGGTATCCCAGCTATCTTGTCTTAATGGGCTATTTCTGCCAAGGGGCTTTGTAAGACTCTCCCAGCTCTGCATAGTTACACTTGTTTTCATACGTGTAACTTTCGTAATGGGGAGAGAGAGAAAGGATCTCCTCAAGATCTCAGATTGGTCTCATTGTGGCCTCTCCTTCCTTGAGGGGCACAACAAGCCCTGGGCAGTGTTTACTGATAATTGTGTAAGCTAGTGGACCACCAGCCACTTCAGTCTCTTCACAGGCATTTGTTGCCATTGGGGACTACAATGGACATGTCGGTTTGGGTGTCAAGTGCTCCAAGGAGGTAGCCACTGCCATCCGTGGGGCTATCATCCTGGCCAAGCTCTCCATTGTCCCTGTGCGGCGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACCGTCCCTTGCAAGGTGACTGGCCGCTGTGGCTCTGTACTGGTGCGCCTCATCCCTGCCCCCAGGGGCACTGGCATTGTCTCAGCCCCTGTGCCCAAGAAGCTGTTGATGATGGCAGGTATTGATGACTGCTACACCTCAGCCAGGGGCTGCACTGCCACCCTGGGTAACTTTGCCAAGGCCACATTTGATGCCATCTCTAAGACCTACAGCTATCTCACCCCTGACCTCTGGAAAGAGACCGTGTTCACCAAGTCTCCCTATCAGGAATTCACTGACCATCTTGTAAAGACCCACACTAGAGTTTCTGTGCAGAGGACCCAGGCTCCAGCAGTGGCTACCACATAATTTTATACAAGAGAAATAAAGTGAATTAAATCTGTTAA