Transcript asmbl_3724

Sequence
Transcript Sequence for observation asmbl_3724 of TGE0004844:
GGCCGGAAGTGACGTTCTGTGCCTGGCTGGCCGCGGAGTCCGCCGAAGCTTTCGGCCGCGGCTGAGGCGGCTGAGCGGAAAAATGGTTCGGACAGTGGCGGCTGCGGCGGCAGGGGTTGTGGTGGAGGCGGAGGCTCAGGCTGCGTGAGTGGGCGTTGTATTGAGAGTAAAGAAGGAGGCCTTCCTCTTTGAACAAGATTACCTATTAAAGAGGTACCCTAAAATCTTTCCAGGTCTTGCTATTTGGGGAGCTACAAAGAAAAAACAAATTAAAGGAAGGTTGGTCTTTTAAGTGGACATGGCTCAGATATCCAGCAACAATGGATTTAAGCAATGTTCGTCTTCACATCTGGAACCACCAAGACCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAAAAAGACAGGCGAGTGACTGATAATCAGAGAGGCTTCGAGTTGTCAGGCAGCACCAGACAAAAAGCACAAGTTTATAACAAACAAGATTATGATCTCATGGTGTTTCCTGAATCAGATACCCAAAAAAGAGCAGTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTGGAGAAACTATTGCTAGATGACAGTTTTGAGACAAGGAAAACACCTGTATTGCCAGTTACTCCTGCCCTGAGCCCTTCGTTTTCAGCACAGCTTTATCTTAGACCTACTACTCTTCAGAGGGGACAGTGGCCAACTGGTTTATCTGGGCCTTCAGCTTATACTTTACCTTCTATTTATCAGTCAACTTACAGCAGTAAACAGACTACATTCCAAAATGGCTTTAATCCAAGAATGCCTACTTTTCCATCCACAGAACCGATATATTTAAGTCTTCCAGGACAGTCTCCATATTTTTCATATCCTTTGTCACCTACTACATCTTTTCATCCACAAGGAAGCTTACCTGTCTATCATCCAGTAGTCAGTCCTGACATGGCAAAGCTGTTTGACAAAATAGCTAGTACATCAGAGTTTTTAAAAAATGGAAAAGCAAGGACTGATTTAGAGATAAATTCAAAAACTACAATCAGCAGCCTACAGGTATCTCCAAAGTCTGAAGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAGGTGGACAATGTGGAGGTATTAGACCATGAAGAAGAGAAAAATGTTCCAGGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCATCAGCAAGTTGTCACCTTGAAAGGAAGGTGAATGGAAAATCTCTTTCTGGGGCAGTGGTAACAAGAAGCCAGTCTTTAACTATTCGAACAACTCAGCTTACAAAAGTCCAGGGCCAAATATCTCAGAAAGACCCAAATGGGACCAGTAGTTTGCCAACTGGAAGTTCTCTTCCACAGGAATTTGAAGTACGGAATGAAGAAGTGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAACTTTCCATACACCAATCACTGCACAAATCCAGGCTATTTATTAAGTCCAGTCACAGTGCAAAGAAACATATGTGGAGAAAATGCTAGCGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCAGTTACTTTTACATGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTGCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTGAAAGTTTGTGGTCAAGAGGAAGTGCTACAGAATAATCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAACTACGACTTTTGACCTTCAGCACAATGTGCCAAAATCTGGCCCGAACTGCAGAAGATGATGAAACACCTGTGGATTTAAACAAACACCTGCATCAAATAGAAAAACCATATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTTTTAGATTCTTATCATAATCAAGTGGAGCTGGCTCTTCAAGTAGAAAACCAGCACCGAGCAGTAGATCAAGTAATTAAAGCCGTAAGAAAAATCTGTAGTGCTTTAGACGGTGTAGAGACTCTTGCCATTACAGAATCAGTAAAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAAGTGCCGATGTGACTTCACTGTCTGGAGAAGGAGACACTAGCAAGAGTTCAACTCGGGGCTCACTGAATCCTGAAAATCCTGTTCAAGTAAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGGAAATTCTGGTAGGAGTCCTGCAGACTGCATCCAAAGTAACAGGAACATCAAGGAAGCGTGGACTACAGCAGAACAGCTCCAGTTTACTGTCTTTGCTGCACATGGAATTTCAAGTAACTGGGTATCAAATTATGAAAAATACTACTTGATATGTTCACTGACTCACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAATGGGATGAACTAATCATTTTTCCCATCCAGATATCACAGTTGCCATTAGAATCTGTTCTTCACATTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGAAAGGGGCCAGAAGCTTTGGGTAAAGTTTCTTTACCTCTTTTTGATTTTAAACGGTTTTTAACATGTGGAACTAAGCTTTTATACCTTTGGACTTCATCACATACAAATCTGATTCCTGGAACAGTTCTCAAAAAAGGATATGTGATGGAAAGAATAGTGTTACAGGTTGATTTTCCTTCTCCTACATTTGATATCATTTATACCACTCCTCAAGTTGACAGAAGCATTATACAGCAGCACAACTTAGAAACATTGGAAAATGATATAAAAGGGAAACTTCTTGATATTCTTCACAAAGATTCATCGTTTGGACTTTCTAAAGAAGACAAAACCTTTTTGTGGGAGAAACGTTATTATTGCCTGAAACACCCAAATTGTCTTCCTAAAGTACTAGCAAGTGCCCCAAATTGGAAATGGGTTAATCTTGCCAAAACTTACTCATTGCTTCAGCAGTGGCCTCCATTGCACCCACTGACTGCATTAGAGCTTCTTGATTCAAAATTTGCTGATCAAGAAGTGAGGTCCCAAGCTGTGACCTGGATCGAGCCTATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTGCAGGCTTTGAAGTATGAAATTTATTTGAACAGTTCATTAGTGCGCTTCCTTCTGTCCAGGGCATTGGGAAATATACAGATAGCACACAATTTATATTGGCTCCTCAAGGATGCCCTGCATGATGCACAGTTTGGTGCCCGATATGAACATATCTTGGGTGCTCTCCTCTCAGTAGGAGGAAAAGGACTGAGAGAAGAACTCTTGAAGCAGACAAAACTTGTACAGCTTTTAGGAGTAGTAGCAGAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAACGAGTACAGTCTTTTTTTCTAAGAAATAAATGTCGCCTGCCTCTCAATCCAAGTCTTGTGGCAAAAGAATTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCTGTGCCCCTAAAAGTCACAATGGTGAATGCTGATCCAATGGGTGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAAATTATGGACAAGATCTGGCTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTTTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACTCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTGAGGAAATACAATCCCTCTGAAGAGGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACAGGACACATGTTTCACATTGACTTTGGGAAGTTCTTGGGCCATGCACAGATGTTTGGTAGCTTCAGAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATCAACGGGGGTGAAAAGCCCACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAACAAACCTCTTTCTTAACCTGCTTTCACTGATGATTCCTTCAGGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGATGCAGAAGCTACAATTTTCTTTACTAGGCTGATCGAATCAAGTTTAGGAAACATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTACTGGTCTTCCTTCCAATGATGAACCCATCCTTTCATTTTCACCCAAAACTTACTCCTTTAGACAAGATGGTCGAATAAAGGAAGTCTCTGTTTTCACTTACCATAAGAAATACAACCCAGATAAACATTACATTTATGTAGTCCGAATTTTGAGGGAAGGACAGCTCGAGCCATCATTTGTGTTCCGAACATTTGACGAGTTTCAGGAACTTCACAACAAGCTCAGTATTGTTTTTCCACTTTGGAAGTTACCAGGGTTTCCTAATAGAATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAGAGAAAAGTTGAGTTAAACAGTTACTTACAAAGTTTGATGAGTGCTTCAACGGACGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTTCACCCTTTACTTCGTGATGAGAAAGCTGAAGGAATAGCTAGGTCTGCAGATGCAGGTCCCTTCAGTCCTACTCCAGGCCAGATAGGAGGAGCAGTGAAATTATCTGTCTCCTACCGAAATGGTACTCTTTTCATCATGGTGATGCACATCAAAGATCTTGTTACTGAAGATGGGGCTGACCCAAATCCATATGTCAAAACCTACCTACTTCCAGATACCCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCAAAGAAACCCTAAGACAGAGAGAACTTCAACTAAGTGTACTCAGCGCGGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAAGATTTCAATTTGAGCAAAGAGACGGTTAGGTGGTATCAGCTGACTGCAGCAACCTATTTGTAAGCTAGTGAATTTGTGAGCTTTGGAAGCAAGAACAGTTAAAACATGTGTGTGCTTGCACACACACACACACACACA