Transcript asmbl_36015

Sequence
Transcript Sequence for observation asmbl_36015 of TGE0004925:
CTGGCTCTTTTCTCTCTGGCCTGTCCCCGCCTCCTCCAGTGCCTCCACTCCCCGCTACCCAGGAAGGCCGTGTGGGTTACGCGCGCTGCTTTCGCTTTCCCTTGGCGGTGCCCACTCCTCGCTCCTCGTGAGGCGCTAGGCCCCCTGCCCCTGCCATGGCCATGCTCAGGGTCCAGCCTGAAGCCCAAGCCAAGGTCGATGTGTTCCGTGAAGACCTGTGTACCAAGACAGAGAACCTGCTCGGAAGCTATTTCCCCAAGAAGATTTCTGAGTTGGATGCATTTTTAAAGGAGCCAGCACTCAATGAAGCCAGCCTGAGCAATCTGAAAGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAAAAAGGGGAAGACGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAGAAGATTGTGATCCTTCTACAGCGCCTAAAGCCTGAAATCAAGGATGTCATTGAGCAACTTAACCTCGTCACCACCTGGTTGCAGCTGCAGATCCCTCGGATTGAGGATGGAAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCGCCCTTCACACCAAGCTGGAAGGCTTTCACACTCAAATCTCCAAGTATTTCTCTGAGCGGGGTGATGCCGTGACCAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGAAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCTTTTCTCATACTGTGATGGGTCCAGCAGAGACCTTCCTATCTTCGACAGGGCACTCCAAACTTTGTCCCACCTTCCACCTATTGAGTTCTCTTCCCCTCCCCAACCCCCTTGCCTCCTAGGCACAATAAATAGAGTCCTAGTGGTACCCAAC