Transcript asmbl_35513

Sequence
Transcript Sequence for observation asmbl_35513 of TGE0004893:
CTGGGATTGGTAGGCTACGTTTCTTCTGTCTGCGGCAGTCACATAAAAAGAAATAAACAACAATGCAAATGAGATATCTCTGAACTTCAGACACATTAAATAAGACGCAGATTCTGGAAAGTGGCGCAAACTAGTCTTTCAAACGAGAGGCGCCAGCGTCGGATCAGGCGCTGCGTGGACAGCCGCACGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAATAGGTTGTGTCTTATTTTCTTTACCACAGAGATATATGCTTTACCAATTTTAGGAGATTTGGAAAATATTTGATTCAGAGTTCTCTAGAGTAAATGCGATTCACAGTAAAGTTTATCCCCTGCATGTAATAAAATAACAGTAAATCTAGAAGAAATAAATGTACAGCATTCTTGTAAAGAGGACTTAACACTGAATTTCTAGCAGTATCATCTTAGGAATTCTTG