Transcript asmbl_34598

Sequence
Transcript Sequence for observation asmbl_34598 of TGE0004857:
GTTTTAGAAGTGTCCCTTTCCTGTCGCGAGTTGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTGCCTGCCAATACTTGGTGTAAAGAAAAATCCCTCATCCCCACTTTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTGAATGTGAGCGAGTTGGGCCTTGTGACACAAGGAGGCAAGGTTATTTGGGGAAAATATGCCCAGGTTACCAACAATCCTGAAAACGATGGATGCATAAATGCAGTCTTACTGGTTTGACAGTAGTTTCATACAAGTAACTCCTTATAATTATTGAAGACTATGCACCAATCAGGAAAACCATCTTTACCTGTGATGTTTCTGAGTACTACCAAACAGGTTACATGTCTGTACTCATTGACCTATTTATTTTATTGTAAAGAACATTAAAATGGTCCAGTTTTATAAATTGGTCTTTATTTTGGGGTCTGTTTAATGTTTAGATGTTCATGAAATGGAATAATTAAAAAGCAGTTATAGAAATGTCCTGCTTTATCAGTATCTGTATTAGTAAGTAGGTATTCAGGAATGCTAATTT