Transcript asmbl_34550

Sequence
Transcript Sequence for observation asmbl_34550 of TGE0004845:
CCTGCATCTCCCAGCGTGCTGCAGAGGAACGGCTGTTGATCTGTGTTGAATTCAGGTCCCCGGCTTGTCGGGGGCTCGAGTTCTCGGCTTCTCTCCTCTGAGCTGCTACCTGTTGAAGAGGAAGCCATGGCGTTCCGGGTCACCAGGAACACGAAAATTAATGCTGAAAATAAGGTGAAGATCAATATGGCAGGCGCAAAGCGCGTGCCTGTGTCCACTGCTGCAGCCTCCAAGCCGGGCCTGAGACCAAGAACCGCCCTTGGAGACATCGGTAACAAAGTCAGTGAACAGCCACAGGCCAAATTACCTCTGAAAAAGGAAGCAAAAACTTTAGCTGCTGGAAAAGTTATTGCTAAAAAAGTACCTAAACCTCTGGAAAAGGCACTGGAGCCTGTGCCTGAGCCTGCGCAGGAGCCTGTGCCGGAGCCTGCATCAGAGCCAGAACCTGAGTCTGTTAACAAAGAAGAAAAACTTTCTCCTGAGCCTATTGTGGTTGATACTCCCTCTCCAAGCCCAATGGAAACGTCTGGATGTGCCCCTGCAGAAGAATATCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTGAACGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAATATGTAAAAGATATCTATGCTTATCTGAGGCAACTTGAGGAAGAGCAAGCAGTCAGACCAAAATACTTACTGGGTCGTGAAGTCACTGGAAACATGAGAGCCATCCTAATTGATTGGCTAGTGCAAGTTCAAATGAAATTCAGATTACTGCAGGAGACCATGTACATGACTGTTTCCATTATTGATCGGTTCATGCAGAATAATTGTGTTCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATCGGTGACTTTGCTTTTGTGACTGACAACACTTACACTAAGCTCCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAATTTTAGTCTGGGTCGCCCTCTACCCCTGCATTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTGGAGCAACATACTTTGGCCAAATACTTGATGGAACTAACGATGTTGGACTATGATATGGTGCACTTTTCTCCTTCTCAGATCGCAGCGGGAGCTTTTTGTTTAGCACTGAAAATTCTCGATAATGGTGAATGGACACTAACTCTACAGCATTACCTGTCATATACTGAAGAATCCCTTCTTCTTGTTATGCAACACCTGGCTAAGAATATAGTCATGGTGAATCGTGGACTTACAAAGCACATGACTATCAAGAACAAGTATGCCACAGCTAAGCATGCTAAGATCAGCACTCTTGCACAGCTGAATTCTGCACTAGTTCAAGATCTGGCCAAGGCTGTGGCAAAAGTGTAACTTGTGAAATTGAGTTGGAGTACTGTAATGATCTGCAAATAAAATTGGCACCATGTGCTATCTGTATATATTACATGTTACATTTATTTACTTTTAATAAAGTTGTGGACCTTTTTACTTCTTACCTTAACTCATTTGAATGTGGCCACTTCCTGCTCTTGGGGAACCCTAAAAGTAGCCTTAAAGATATGCTAGGGAATATAGAGTATTAAAAAAAGCGCTTTCAGTTAAACTAGGGACCCAACTAATATATATAATTGTTGCTTATATGATTCTTGTTTTATATACCTACCTGGATTTTGCTTTATAAATAGGAATTACTAAGGTTATGAAGGCATTTAAAACCCTTACCTTCCATAGGGCATACTGCATGTAAGCCTAGTCATCTTGGAGCATCTGCTGCCTTGTTCTACTTAAGTAAAAGTCTGCCACCTCATCCCTAGTCCGCCATTTTCTGTTTCTTCTGGTGTTTGCTGCCATAAATTCTAAGTAATCTACTTTTACCACTATTTCTTAAATTATCAACTTTAGTATCAACTTTTTCACTTGGAAAAATGACTTTATATTCTAAACATACTTTACTTTTTCTTTATTAGTTGAGAAAATAAAACAGACTCCTCAAAACATACCAAAGTATCTTAAAAAGTTTATTTTACCTCTCCCCGCAACTCTCCTACATCTCCACGCCCTCGACCTGAAGATGTCAACAGTTTGAGATGTAGCCTTCCATGACTTCTATAAACATAGATGTGCATAGATATAAATTGTCATGGAGATTTTAAAACATAAGATTTTTCTACATGCTTAGCAATTCCTTTCAATATGTATAGACATCTGTTTTAGGGTATTACGTTCCAGAGTATAATGTATTCAGTCATTCAATTGACATTTGGATGGCTTTTTTCTTTGCCCCTAAAGACAATGCTGTTTAAATATCATTAAGTATCATGTTGGTTTTTTGGGGGTTTTTTTTACATAAATTGGGTTCTCCAAAGGGTATGTGTGTTCTCACTTAAAGCAGGTCCTGTCAAATGACTTTCTCAGTGTCATCAGCAATGTACAAAAGTGCTGGTTTTCTCTGCAGTTTTGTCAAAACTAAAGATAATCTCTTTAATTTCTGTGAATTTGGGAATTCTACCTTGTTTGCTGTTTTAATGTATACTCCTAATGATTACTTGAATAAATTTTTGTTGTCTACTAACTTTTCAATGTGTAAGCCTTTCCCAG