Transcript asmbl_14935

Sequence
Transcript Sequence for observation asmbl_14935 of TGE0000340:
CCGGAAGCGGAAGAGAGGGCGGGGACGTGTTTGGCAGCGGGACGCACCATTTCAGTTGTGTTCTTGGTTCATTTCGTGTCTCGGCGATGTTTCCTAGAGTCTCGACGTTCCTACCTCTTCGCCCCCTTTCCCGCCACCCTTTGTCCTCTGGAAGCCCGGAGACATCAGCGGCTGCGATTATGCTACTCACTGTTCGGCACGGAACAGTCAGGTACCGCAGTTCAGCGCTGTTGGCCCGGACAAAAAATAACATCCAAAGATATTTTGGCACTAACAGTGTGATCTGTAGCAAGAAAGATAAGCAGTCTGTTCGAACTGAGGAGACTTCCAAGGAGACTTCAGAGAGCCAAGACAGTGAAAAGGAAAATACGAAAAAAGACTTGTTAGGCATTATTAAGGGCATGAAAGTTGAATTAAGCACAGTAAATGTACGAACAACAAAGCCCCCCAAAAGAAGACCACTTAAAAGTTTGGAAGCTACACTTGGCAGGCTTCGAAGAGCTACAGAATATGCTCCAAAGAAGAGAATTGAGCCCCTGAGTCCTGAGTTGGTGGCAGCTGCATCTGCTGTGGCAGATTCTCTCCCTTTTGATAAGCAAACAACCAAGTCAGAGCTGCTGAGCCAGCTCCAGCAGCATGAGGAAGAGTCAAGGGCACAGAGAGATGCAAAGCGACCTAAAATTAGTTTCAGTAACATAATATCAGATATGAAAGTTGCCAGATCTGCTACAGCTAGAGTTCGTTCAAGACCAGAGCTTCGGATTCAGTTTGATGAAGGCTATGACAATTATCCTGGCCAGGAGAAGACGGATGATCTTAAAAAAAGGAAAAATATATTCACAGGGAAAAGACTTAATATTTTTGACATGATGGCAGTTACTAAAGAAGCACCTGAAACAGACACATCACCTTCACTTTGGGATGTGGAATTTGCTAAGCAGTTAGCCACAGTAAATGAACAACCCCTTCAGAATGGATTTGAAGAGCTGATCCAGTGGACAAAAGAGGGGAAACTATGGGAGTTCCCAATTAACAATGAAGCAGGTTTTGATGATGATGGTTCAGAATTTCATGAACATATATTTCTGGAGAAACACCTGGAGAGCTTTCCAAAACAAGGACCAATTCGCCACTTCATGGAGCTGGTGACTTGTGGCCTTTCCAAAAACCCATATCTTAGTGTTAAACAGAAGGTTGAACACATAGAGTGGTTTAGAAATTATTTTAATGAAAAAAAGGATATTCTAAAAGAAAGTAACATACAGTTCAATTAAGACCATGGAAATT