Transcript asmbl_33800

Sequence
Transcript Sequence for observation asmbl_33800 of TGE0004810:
CAGGAGTTACTGGATCCTGAAGACCATCCCTGGATCTCGGGTTAAAAATCTGTTCTAATCTGAACCGTGGGAAGAAAGGGTCCTTGGTCGGCGGTATTCCCACCTGAAGGACATGATGTTTTCCAAACTAGCACATTTCCAGACCGTTGCCGTGCTGCGTCGAGGAGTTCACTCTTCAGTGGCTTCTGCTACATCCGTTGCGACTAAAAAAACAGTCCAAGGCCCTCTATCCTCTGATTACGTTTTTGAAAGGGAATCGAAATATGGCGCACACAACTACCATCCCTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATCTACCTGTGGGATGTAGAAGGCAGAAAATATTTTGACTTCTTGAGTGCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCAAAGATTGTGAATGCTCTGAAAAGTCAGGCAGACAAACTGACCTTGACATCTAGGGCATTCTATAATGATGTACTTGGTGAATATGAAGAGTATATTACTAAACTTTTCAACTATCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCTTGCAAGCTTGCTCGTAGATGGGGATATACCGTTAAGGGTATTCCGAAATACAAAGCAAAGATCGTTTTTGCAGCTGGAAACTTTTGGGGTAGAACTATGTCTGCTATCTCCAGTTCCACAGACCCAAACAGTTACGAAGGTTTTGGACCATTTATGCCAGGTTTTGAAATCATTCCATATAATGATCTGCCCGCTCTTGAGCGTGTTCTCCAGGACCCGAACATCGCCGCATTCATGGTGGAGCCCGTTCAGGGCGAAGCGGGCGTCATTGTGCCAGACCCGGGCTACCTGACAGGCATCCGTGAGCTCTGCACCCGGCACCAGGTTCTGTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAAATGGCTGGCCGTCGATCATGAAAATGTCAGACCTGATATAGTCCTTCTTGGAAAGGCGCTTTCTGGTGGCTTATACCCTGTGTCCGCAGTACTGTGTGATGATGAAATAATGCTGACCATCAAACCAGGGGAGCATGGGTCAACGTTTGGTGGCAACCCGCTGGGCTGCCGAGTGGCCATGGCAGCCCTCGAGGTTTTGGAAGAAGAAAACCTTGTTGAAAATGCAGATAAAATGGGTACCATCTTGAGAAACGAACTCATGAAGCTACCATCTGATATCGTAACTGCTGTAAGAGGGAAAGGATTATTAAACGCTATTGTTATTAGAGAAACCAAAGATTACGATGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGACATTATCAGGTTTGCACCTCCGCTTGTGATCAAGGAAGACGAGGTTCGGGAGTCCATGGAAATCATTAACAAGACCATCTTGTCTTTCTGAGGGTTGCGACTGTTTTCGGCGGTGCCTGTGAGTCAGCTGGAGACAGGCAGACAGTTCCTTGAAGTCCTGTAAAAAGCTTCTGCATTTTTGTGTGTGATGCAGGCACATTCCACTCCCTGTGTCTTCAAGGACTTATTTTTTAATATACATATTTTTCAGTTCATACATAATAGAGTGACATTTATAATCGTGCAGTATGCCATTTAACATAACTGTAAGAGAATGTAATGACATCTATATTCGATTGTTTTTGTGTACTTGTGTACTTTCTGAAGTGAAATGCATCTATTTGTCTGTCTGTAGGCAGCCTTACAATCAAGCCCCATATAACTTATATATGTTTTTATAATTTCTGGTGTAAATGTTTTATATTTGAAAAAGTTATATGGGGTTTTACATAAAAGACTTCTTTAACCTTATGAAGCTGAATTATAATCATTGAATTTTAGGAAGGTTAAGCTTATATAAAACACTAGATTTAAATAAACTTCATATTGGCCAACATCAGAATATATTCCATGAGTGT