Transcript asmbl_33441

Sequence
Transcript Sequence for observation asmbl_33441 of TGE0004797:
GGAGGCTGACATCACCACAGCAGCAGTCTTTAAACCCCTCATCCAGCCAGCGCCCCATCCTGTCTGTCCAAGTCCAGACAGAGCTGACTCCTTCCTTCAAGCCTTGAAGAGCCCCTCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATATCTATCTATCTATCTCAATCTTTTCTCGGGCCTGGCTGGTAGAGTTTGATTTGCCCTAGTCACTTCCGTGTGGTTTCGGGAAATACAAACAGGGAACAGGGCCACCTGTGTTGTCCTGGTTGCCATCCTCTGAAGGACTCTTCACATTCCAGGATTCCAGGGGGTCAGATTCTTTCAGACAACCAGGCAGTGGAAGAAAGTGAATCTCTGGGGGACTGACAGGAAGGAGGAACTACTTGGCAACTTGCATTAGCTCTGGGGAGGCAGAGGAAAGGAGATGCAGAATGGCAGAATTGTGTGGAAGGTTTTTATTCTGGAAAAGCTGTGCAGAAAAAAATTCAACGAAATGTTGCTGTGAAGAGAAAACCAAGCCTTAAGTGTTCACTTTGCAGAGGAAGACAGGATGGTAGCAGGGTTGGGGCAGCAGTGGCTGATACCTGCCACAGTCCTGAATAGACTCCCCTAGTGAAGCAGCACAGCCCTAGGTGCTGTGCCCATTCCCAGCTTTGCCAGGAGCACTGTACCGGTCCTTCGGGATGAAGGGTGGGGGTGATGGTGAAGGAGTCAGGGGTGTGTTCATGGTTGGCTTCTGATCAGGCAGCTGCTTTCAGGGCAAGTGTGCTGGGCTGAGAGCTGATTGCCATACCAGAATGTCCAAGGTCCAAGTCTTAGGTAGGAAGGCAAGGGAGAGAGGAAAAGCCTGCTGTTTCTCGGTTCCTGGGTCATTAGCAGGATGTGCATATCCAGGGGCTCTTCCCAGAATCCATCCCTGAGCCCTTTTCCCAAGTGACCCCAGTGATATTTCTGCTGAGATGCTCTTCTGGCCATGGTGGGTACCTTCTCATCCATGCATGGGTGAGGGTCCCTATGACCTATACCAATGACTTGCCCAGGAGAAATGAGGATGGAGGCCTGCCCAATGGGGAACAGGGGACAAGCTCTCGTCCAAGACCTTGGCAAAATCTCCTGTTCGGTTTGAGGAAGATCCTGTGGCTGCTGCCACACTGCTCTCCAGCACCATTCCTCTGCCAGTTGTACCTTAAGAAAGCCCCAGCCCTCCCTGAGCATAGACTCCGGACTCCAGCTGGAAGTATCAGGACGACCTTCTCCTGAGAGCTCCCAGGACTTCGGAGCAGCTTTCAGAGCTTCCCCAATTTGGGGAAGGAGGAGCCTACTCCATGTTGAGTCTGTTAGGCCCTGGGTCAGCAAATCTCCTCCTTCCCCTGCAGCAGGTCTGGGGGTATGTGCTGACGAGGGCAGTCCAGGGCACTCCTGTTCTGGGACAGGCTCCAGTCTCCTTGATCCAGCAGGTCTGGGACAAAGAGACCAGAGGTGGCAGAATGGCCTTCACTCTCTGTCTCCACTCCATCTGGATCCTTGCTGTTACAAAGTGGCACTGATTCTAGTTCTGTCCCCTCTTTCCTGGCTTTTCGGCTTCGTTGGGGCCAGTGGCAGGGTCCACTCCTACAAACCGGGTGAGAGGCCACATTCTTCTGGTTCAAGTATACTTCTAGCATGTAGTATACTGTCCATAAGATGGTAAAACAGCCGACCAGCAGCAGGGTCTGCGGGGAAAGTCCACCACCTAAGTTAGGGACAGTTTCCCA