Transcript asmbl_33298

Sequence
Transcript Sequence for observation asmbl_33298 of TGE0004785:
AGTGGATCTGCTGCTCTGGCTACGGGAGAGTGACCCTGTGAGCATTGGGTCTTGTCGTGGCGATGGCCTCGTTCGTGACAGAAGTTCTGGCACACACGGGGAGTCTGGAGAAGGAGGATCTGGGCACTCGGATCAGCCATCTGACTCGGCGGGTGGAGGAAATCAAGGGTGAGGTGTGCAGTATGATCAGCAAGAAGTACAGTGAATTCTTGCCTAGCATGCAAAGTGCACAGGACCTTGTTACACAAGTGGACAAGCTATCTGATGACATTGACCAGCTGAAATCCAGGATAGAGAGTGAGGTCCGCCGGGATCTTCATGTATCAACCACTGAATTTACAGACTTGAAACAGCAATTGGAAAGAGACTCGGTAGTCCTCAGTTTGCTTAAACAGCTACAAGAGTTTTCTACTGCTATTGAAGAATATAATTGTGCATTAGCAGAGAAGAAGTATGTCACTGCTGCTCACCGTCTAGAAGAGGCACAGAACTGCTTGAAGTTATTAAAATCCAGAAAATGCTTTGATTTAAAAATGTCGAAATCTCTCAGCATGGAGCTTACGATACAGAAACAGAACATACTGTATCACCTTGGAGAGGAGTGGCAGAAGCTGATTATATGGAAGTTCCCACCATCAAAAGATATGAGCAACTTGGAATCTTGTCTACAAACAGAACTTCATTTATACACTGAACAGTCTCAAAACGAAGAGAAGACCCCTGTGCCACCAACCAGTTCTGTCCTCTTGGCATTTTCTATTCTAGGAGAGCTACATACCAAGCTTAAATCATTTGGTCAGATGCTGCTGAAGTATATTCTTAGGCCTTTGGCAACTTGCCCCTCCCTTTTTGCTGTGATAGAAAGGCAGCCTAACATCATTATTATTCGTTTTGAATCTGTGATGACTGACTTGGAACATCCATCACCATCTGAAGTTTTTGCGAAGATCAGACTGGTGTTGGAAGTGCTGCAGAAACAACTAGATTTCCCTCTTGATGCTGATCTAGAAAATGAAAAAACATCTAAGATCATATTGGCTGAGATGCTTGGTGACACGATCTGGGAAGACTTGTCTGAGTGCCTCATTAAAAACTGTTTGGTTTATTCTATCCCAACAAATAGCAGCAAGTTACAGCAGTATGAGGAGATCATACAATCCACTGAAGAATTTGAAAATGCCTTAAAGGAGATGAGGTTTTTAAAAGGAGATACTACTGATTTGCTGAAATATGCCCGTAACATCAATTCTCATTTTGCTAACAAGAAATGTCAGGATGTGATTGTGGCAGCTAGAAATCTAATGACCTCTGAAATTCACAACACTGTGAAGATTACTCCTGATTCTAAGATAAGTGTACCTGACTTACCCAGCCCTGATGTGGATGACAAGCTACAAGTACAGAAAATGTCCATAACTCAGTACAGTGAAGTGGTGAATTTAGAGCCTGAAAATACATTGGACCAACATTCCTTTTCTTTGCCCACATGTCGTGTCAGTGAATCTGCGAAGAAATTAATGGAACTTGCCTATCAGACTTTACTAGAGGCGACAACCAGCAGTGATCAGTGTGCTGTTCAACTTTTCTACTCAGTAAGGAATATCTTCCATTTATTCCATGATGTCGTACCAACATATCATAAGGAGAACCTTCAAAAACTGCCCCAGTTGGCTGCCATTCACCATAACAACTGTATGTATATTGCTCATCACTTGCTGACCCTGGGACATCAGTTCAGATTTCGTCTTGCTCCCATTCTTTGTGATGGCACTACTACTTTCGTGGATCTTGTACCTGGCTTTAGGAGACTTGGGACAGAGTGTTTTTTGGCCCAAATGCGAGCACAGAAAAGAGAACTTCTGGAAAGATTATCAAGTGCTAGGAACTTTTCAAACATGGATGATGAAGAGAACTATTCTGCAGCAAGTAAAGCAGTCCGTCAGGTACTGCACCAACTAAAGAGACTTGGAATTGTGTGGCAGGATGTCCTGCCCGTGAATATATATTGCAAGGCTATGGGGACTTTACTCAATACTGCAATTTCTGAGATCATTGGCAGAATCACTGCCCTAGAGGACATCTCTACTGAAGATGGTGATAGATTGTATTCCTTATGCAAAACAGTGATGGATGAAGGACCTCAAGTATTTGCACCTCTATCTCAGGAAAGCAAGAACAAGAAATATCAAGAAGAGGTTCCAGTCTATGTGCCAAAATGGATGCCATTTAAAGAATTAATGATGGTGTTACAGGCCAGCCTGCAAGAAATTGGGGATCGGTGGGCAGATGGAAAAGGGCCCTTGGCAGCTGCATTCTCTTCCAGTGAAGTAAAAGCTTTAATTCGTGCCTTGTTCCAGAACACAGAAAGAAGAGCAGCTGCCCTTGCTAAGATTAAATAGCTCCACCTTCCCGAGAAAGCCATGTCTTTACTATGGATTTCTCTCTTGGCATAATTACTCATTTAGAGACTTCTTAGAGTCACCCACTGGTTTTGGTGAACCAATATATCATGGAAGTTTTATTTCACCTAAGAACGCCTTACCTCTTGGCTTGTAGGAGGCCATGTTGAATAACTGGATGTTAAGATGTCAAGTGAAGCACCTTACTTTGTTGAATTTCTAGCCACCCTTCTTAGATAAGAAACTGTAGAGCAGCATTGTTTTATGTTACTTCTAGGGCCTTCTGGGAACCATATCCATTGTAAATGTAGGCCCTGGCCTCGGATCAAGGAATCCAGGAGATTCCAGGAGTCAGGGTAAAGAATTTGTGAGCAAACAGGAGATATATTTTGGGGGGTAGGGGAACCATATTTGGCTTTGCAGAAATTAAGAAGACTTCCTTTAAGATTTTTTCCAATAAATAATGCTTTTAAGAGTGA