Transcript asmbl_33210

Sequence
Transcript Sequence for observation asmbl_33210 of TGE0004781:
CGGCGTCCTCCCTCCTTGCAGATCCTGCGCCTGAAGAGACGCAGGCAGCTGACATTGTCTTCTTCGCGCGACTCTTTCTGCAGTCTGGAGAGTCCTCGGCCTCCTGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTG