Transcript asmbl_33199

Sequence
Transcript Sequence for observation asmbl_33199 of TGE0004776:
GCCTTGGGCTGCAGAACTGCCCAGAAGAGTGCCGAGAAGGTGGCGCGTAACTTCGGCAGATCCCAGAAGTGCAGCTAGGAAACTTGCCCAGCCAGCCAGGCCCATAGGGTGCTAGAGGGTCAGGAAGGACCCGCCTTTCCTAGACCGTGGCCCAACAGATCCACGTGAGGCTTCCTCGCCACCAAAAGCCCCAAACAAGCAGGGCTAATGAAAGAGGAAAGTTAAGGACGTCCCAAGCTCTGAGACGCGGCGCCCCGCTGCCGGCGCAAGAGCTGCTCTTCCAACAGCTGCGCTTGCAGTCGCCTTGTCCAGCCGAGCGGAGGTCGCTGCCGCTGAGTGATGTCCCGCCGCAGCCTGGACGGGCGCCTCCTCGGGCTGCCCGCGACGTCGGCCCCGCCGCTGCCCCCCAAGTTGCTGCTGTTGCTGCTGCTGTCGGCCGCCGCGGTGCCACCGAGCCTGGCAGAAGTCTTCTATGCAACTGCGTACTGGATGCCTGCTGAAAAGACAGTAAATGTCAAAAATTTACTGGACAAGAATGGGGATGCCTATGGCTTTTATAATAACTCTATGAACACCACAGGCTGGGGGATCCTTGAGATCAAAGCAGGGTATGGTTCTCAGACCCTGAGCAATGACATCATCATGTTTGTGGCTGGATATTTGGAAGGTTACCTCACTGCCCCACACATGTATGACCACTTCATAAATCTCTACCCACAGCTGATTAAGAAACCTTCCATCGTGGATAAAGTGCAGGAGTTTATGAAGAAGCAAGAAGAATGGGCACGTAATAACATCAAATATTATAAGGATGACCCATTTTGGAGACATACTGGCTATGTTATGGCACAAATGGATGGGCTGTATGTAGGAGCGATGAACAGGGCTACATTAATAGGGACAAAGCCTATGACACTGTTCCAGATTCAGTTCCTGAATGCTGTTGGAGATCTGTTGGATCTGATTCCCTCACTTTCTCCCCCAAAAAACTCCAGCCTGAAGGTTTTTAAGAGATGGGACATGGGACACTGCTCTGCTCTTATTAAGGTTCTTCCTGGGTTTGAGAACATCTATTTTGCTCACTCAAGCTGGTACACGTATGCAGCCATGCTCAGGATATATAAACACTGGGACTTCAACATCGTCGATAAAGATACCAGCTGTAGTCGCCTCTCTTTCAGCAGTTACCCAGGATTCTTAGAGTCTCTGGATGACTTTTACATTCTTAGCAGTGGTTTGATATTGCTGCAGACCACAAACAGCGTGTATAATAAAACCCTACTAAAGTTTGTGACACCCCAGTCTCTCCTGGCCTGGCAAAGGGTCCGCGTGGCCAATATGATGGCCAATGGTGGCAGGCAGTGGGCAGAGATCTTTTCAAAATACAATTCTGGCACCTATAACAATCAGTACATGGTCCTGGACCTGAAGAGGGTAAAGCCAAAATATAGCCTTGACACAGAGACTCTGTACATTGTGGAGCAAATTCCTTCATATATAGAATTTTCTGACCAAACCGATGTCCTACGGAAAGGATACTGGCCCTCTTACAACATTCCTTTCCATGAAAAAATCTACAACTGGAGTGGCTATCCAATGTTAGTTCAGAGGCTGGGTTTGGACTACTCATATGATCTGGCTCCACGAGCCAAAATCTTCCGGCGTGACCAAGGGAAAGTGACTGATATGGCATCCATGAAATATATCATGCGATACAACAATTATAAGAACGATCCTTACAGTAGGGGTGATCCGTGCAATACCATCTGCTGCCGTGAGGACCTTAACTCACTTAACCCAAGTCCTGGAGGTTGCTATGATACAAAGGTGGCAGATATTTACCTAGCATCACAGTACACAGCACATGCCATTAGTGGTCCCACAGTACAAGGTGCCCTCCCTGTTTTTCACTGGAACCAGTTCAACAAAACTCTCCATGAGGGCATGCCAGAAGCCTACAACTTTGATTTTGTGACCATGCAACCAATTTTGAAACCTGACAAAAAATGAAGGGGGAATATGAGGGAATAGAAGGCTGCAAATAAGATACCAAAGGCACTATTTTAACTGTTTTTCCATTCAAGATTA