Transcript asmbl_14926

Sequence
Transcript Sequence for observation asmbl_14926 of TGE0000339:
GGGCGCGCTTCCGCCTGTGTGGAGGTGCGGGATTGGGCGGGCTGCCACGGCATGGAGAATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCTCGGCGCGGCGCTGGCGGCCGCAGCCCTCGTACTGATTTCCATCGTTGCATTTACAACTGCTACAAAAATGCCAGCACTCCATCGACATGAAGAAGAGAAATTCTTCTTAAATGCCAAAGGCCAGAAAGAAACTTTACCCAGCATATGGGACTCACCTACCAAACAACTTTCTGTCGTTGTGCCTTCATACAATGAAGAAAAACGGTTGCCTGTGATGATGGATGAAGCTCTGAGCTATCTAGAGAAGAGACAGAAACGAGATCCTGCGTTCACTTATGAAGTGATAGTAGTTGATGATGGCAGTAAAGATCAGACCTCAAAGGTAGCTTTTAAATATTGCCAGAAATATGGAAGTGACAAAGTACGTGTGATAACCCTGGTGAAGAATCGTGGAAAAGGTGGAGCGATTAGAATGGGTATATTCAGTTCTCGAGGAGAAAAGATCCTTATGGCAGATGCTGATGGAGCCACAAAGTTTCCAGATGTTGAGAAATTAGAAAAGGGGCTAAATGATCTACAGCCTTGGCCTAATCAAATGGCTATAGCATGTGGATCTCGAGCTCATTTAGAAAAAGAATCAATTGCTCAGCGTTCTTACTTCCGTACTCTTCTCATGTATGGGTTCCACTTTCTGGTGTGGTTCCTTTGTGTCAAAGGAATCAGGGACACACAGTGTGGGTTCAAATTATTTACTCGAGAAGCAGCTTCACGGACGTTTTCATCTCTACACGTTGAACGATGGGCATTTGATGTAGAACTACTGTACATAGCACAGTTCTTTAAAATTCCAATAGCAGAAATTGCTGTCAACTGGACAGAAATTGAAGGTTCTAAATTAGTTCCATTCTGGAGCTGGCTACAAATGGGTAAAGACCTACTTTTTATACGACTTCGATATTTGACTGGTGCCTGGAGGCTTGAGCAAACTCGGAAAATGAATTAGGTTGTTTGCAGTCTTCAGTTGTGTTCTTATGCTTCAGTGTCACATTTCATTTCATTTGAAAC