Transcript asmbl_32060

Sequence
Transcript Sequence for observation asmbl_32060 of TGE0008917:
CTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGTTACTTACGTAATCTTACCTGGACGCTTTCAAACCTTTGTCGCAATAAGAATCCTGCACCCCCCTTAGATGCTGTTGAGCAAATTCTTCCTACTTTAGTTCGCCTCTTGCATCACGATGATCCAGAGGTATTAGCAGATAGCTGCTGGGCCATTTCCTACCTTACTGATGGTCCAAATGAACGGATTGAAATGGTCGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAACTCCTAGGGGCTACTGAATTGCCAATTGTGACTCCTGCGCTAAGAGCCATAGGAAATATTGTCACTGGGACAGATGAACAGACTCAGGTTGTTATAGATGCGGGAGCACTTGCCATCTTTCCAAGCCTGCTAACGAACTCCAAAACTAATATTCAGAAGGAAGCTACATGGACAATGTCTAACATCACAGCTGGCCGCCAGGACCAGATACAGCAAGTCGTGAATCATGGATTAGTCCCATTCCTCATTGGCGTTCTCTCTAAGGCAGACTTTAAGACACAAAAGGAAGCTGTATGGGCTGTGACCAACTATACAAGTGGTGGAACGGTTGAACAGATTGTATACCTCGTTCGTTGTGGCATAATAGAACCACTGATGAACCTCTTAACTGCGAAAGATACCAAAATTATTCTGGTTATTCTGGATGCCATTTCAAATATTTTTCAGGTGAATCTTAACAAGGTGGAATTTATTTGAATTTGGGCTTGATAATTAGCTTACTGTTTATA