Transcript asmbl_31954

Sequence
Transcript Sequence for observation asmbl_31954 of TGE0008906:
ATTCTAAGCTGCCTTTACATTGTCTTGGGTTTATCTAAATAACTTCCATATCCACTGCCATAAAGGTGCACTAAACCGAGTATAGACATGGAACACGCTTGACATTTCTATTTTCAATTTATTGGAACTATCTAATTTGCGTATAGAAAATTGTGTATCTTGGTCATCAACCGTTCGTAGCTCATCTACACGTTTTGCTGTCGTTAGATTTTACTGTTCTCCAAGATATTAGAGCTTAACGGACTGGGCGGGAGATTTCACCACGTTTCGGTTTTTCCGCATATTTTGTCTGAAGTAACTGTAACTGTGATTTCCTTAGGAACTCATCTTCGAGGCTTGGAAACCACAGCCACTTACGACCCCGAAACCCAGGAGTTCGTTCTCAATAGTCCTACCGTGACCTCCATCAAGTGGTGGCCTGGTGGGCTTGGAAAGACTTCAAATTATGCGATAGTGCTTGCCCAGCTCTACACTAAGGGGAAGTGCTATGGATTACACGCCTTCATTGTACCCATTCGTGAGATGGGAACCCACAAGCCTTTGCCAGGTATTACCGTTGGTGACATTGGCCCCAAATTTGGCTATGATGAGGTGGATAATGGTTACCTGAAGATGGACAGTTACCGTATTCCCAGAGAAAACATGCTGATGAAGTACGCCCAGGTGAAGCCCGACGGCACGTACGTGAAACCCGTGAGTAACAAGCTGACCTACGGGACCATGGTGTTTGTCAGGTCCCTCCTTGTGAAAGATGCCGCTCAGTGCCTATCGAAGGCGTGCACCATTGCCATCCGGTACAGCGCCGTGAGGCACCAGTCTGAAATCGAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAGACCCAACAATATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCATTTTGTGGGCGCATACATTAAGGAGACCTATCATCGGGTTAATGAGGACATTGGCCAAGGGGACCTGAGTGAGTTGCCCGAGCTTCACGCGCTCACTGCCGGGCTGAAGGCGTACACCACCTGGACGGCGAGCAGTGCTATTGAAGCTTGTCGGATGGCTTGTGGCGGCCACGGCTTTTCTCACTGCAGCGGTCTCCCCAGTATTTACGTCACTTTTACCCCAACCTGCACCTTCGAGGGAGAAAACACTGTCATGATGCTGCAGACGGCTAGGTTCCTGATGAAAAGCTATGACCAGGTGCGCTCAGGAAAGCTGCTGTGCGGCCTGGTGTCCTACTTGAACGACCTACCCAGTCAGCGCATCCAGCCACAGCAGGTGGCGGTCTGGCCGGCTGTGCTGGATATCAGCAGCCCCGACAGCCTGACGGAAGCGTATAAACTCCGAGCAGCCAGATTAGTAGAAATTGCTGCGAAAACCCTTCAAGCTGAACTGAGTCACAGAAAAAGTAAGGAGGTCGCTTGGAACCTCAGTTCCATCGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGACAGTTAAGCTCTTTTCAGAAAAACTCCCCAAAATTCAAGATAAATCCATCCAAGCTGTCTTGAGGAATTTATGTCTCTTATATTCTCTGTACGGAATCAGTCAGAAGGCAGGGGATTTTCTTCAGGAGAGCATTCTGACAGACTCTCAAATTGCCCAAGTACACCAGCGTATCAAGGAGTTACTGACCGTCATTCGCCCAGATGCTGTTGCTTTGGTTGATGCGTTTGATTTTCAGGATATGTCACTGGGCTCTGTACTTGGCCGCTATGATGGGAATGTGTATGAGAACTTGTTTGAGTGGGCCAAGAAATCCCCACTAAACAAAGAAGAGGTCCATAAATCTTTCTACAAGTACCTGAAGCCTTTGCAGTCCAAACTCTGAATGTCACGACGAGTTTATTCTGCCCCAGGAAGCAGCTGTACTCTGCTGCTCCCCTGGTACCTGCCACACAAATCTACGCGGAATCTTTATCGAATTCGGAGAGCTATAGAGCAAATGATAAATTGGCCCCTTTCCCATCTATAAATAAAAAAATGAACAGCTTACAGAAATTAAATGAAAAAAACATGTTTTTAAGTGCAATTAACACTGAAAGAGACCCGTTAAGCATTCAGAAAAAGCTTTGAGAAATGTACTCTGACTTCCATATGTACAGCTGCTGATCCCAGGAGGCCATAACTTACGATAATTAGTAAAACTTAACTACTGAGTAGTTAATTATTTTCACATCTTAATTGCACATCACTGGATATATGTGTTTTTAAGCAAAGGTATTTTTAAAAGGGTACAACCCTTCCAAGTTTTCCTGCTTAGTGTCCCTGTCACTACTGTCATGGGCCTTGGCTTAAAAGCAGGACCCGAGGCTGGATTGGGGGAAAGAAACCAATCAGAAACTTTAGTGTGAGTTTGTGCTTAACTCATCTTCTGCCTGCTTGCCCTTGGTTGCTGACATAATGTTTCTGTTTGTTCATAGTAGCATTTTTCCTACACAGGGATTTCTTCAGCACAGAGCTACTACAGGGTCATTGTCCTATGTGACTGGGAATCGATCTTCCACTCGAAGGATCCTAAAATTGTCACTGTAGTAGCACTGCAACTCCCTGTGTCCCCAACTTCTAGTGGAGGGGTAGGTAGCAAAGTTATCTCTACATAGGACTTTTGGCAGCTAATGGGACTCAGTCAGTGGTGTTTGATCTCCCTCCATCCCTGTCCCTTAACCTCTCCTGAAAGAGATGCCGGAGGAGAAGAGAGTCACAGTTCCCTCCTAGTAGAATATGTATAGGGAAAGCTCTCGGTTACGGTTACGGTAACTTTGGGTACCATAGTAACTGGTAGATTTCATATATTCTGTTATATTGGCATAAACCATTAAAATGCTTGGAAGTTACAGTACCTTGCATTAGGAAAGTAAAATCATATTTCAGGTTAACTCTTAGACCCAGGGGTAGCACAGAAAAATCTTTTGACAAACCATGTGTTCTGATTTTTGGATCAGAAAATATAATCTTTGAAGGATAAAGGATAAATGGGACTTCCATAGGATCTCTTTCTTTTTTTCGTTTAGGTGAGGCAACACCCTTGGTGGACCTCACAGATTGCAAGGAACTTGTCAGCTTACAATCCCTTATT