Transcript asmbl_31952

Sequence
Transcript Sequence for observation asmbl_31952 of TGE0024233:
GGCCTAAACTGCCTCTTGGGATTAACAGAAGGAAGCCTGAGTCCCATGTTCCTTCTCCAGGTGAAGCCCGACGGCACGTACGTGAAACCCGTGAGTAACAAGCTGACCTACGGGACCATGGTGTTTGTCAGGTCCCTCCTTGTGAAAGATGCCGCTCAGTGCCTATCGAAGGCGTGCACCATTGCCATCCGGTACAGCGCCGTGAGGCACCAGTCTGAAATCGAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAGACCCAACAATATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCATTTTGTGGGCGCATACATTAAGGAGACCTATCATCGGGTTAATGAGGACATTGGCCAAGGGGACCTGAGTGAGTTGCCCGAGCTTCACGCGCTCACTGCCGGGCTGAAGGCGTACACCACCTGGACGGCGAGCAGTGCTATTGAAGCTTGTCGGATGGCTTGTGGCGGCCACGGCTTTTCTCACTGCAGCGGTCTCCCCAGTATTTACGTCACTTTTACCCCAACCTGCACCTTCGAGGGAGAAAACACTGTCATGATGCTGCAGACGGCTAGGTTCCTGATGAAAAGCTATGACCAGGTGCGCTCAGGAAAGCTGCTGTGCGGCCTGGTGTCCTACTTGAACGACCTACCCAGTCAGCGCATCCAGCCACAGCAGGTGGCGGTCTGGCCGGCTGTGCTGGATATCAGCAGCCCCGACAGCCTGACGGAAGCGTATAAACTCCGAGCAGCCAGATTAGTAGAAATTGCTGCGAAAACCCTTCAAGCTGAACTGAGTCACAGAAAAAGTAAGGAGGTCGCTTGGAACCTCAGTTCCATCGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGACAGTTAAGCTCTTTTCAGAAAAACTCCCCAAAATTCAAGATAAATCCATCCAAGCTGTCTTGAGGAATTTATGTCTCTTATATTCTCTGTACGGAATCAGTCAGAAGGCAGGGGATTTTCTTCAGGAGAGCATTCTGACAGACTCTCAAATTGCCCAAGTACACCAGCGTATCAAGGAGTTACTGACCGTCATTCGCCCAGATGCTGTTGCTTTGGTTGATGCGTTTGATTTTCAGGATATGTCACTGGGCTCTGTACTTGGCCGCTATGATGGGAATGTGTATGAGAACTTGTTTGAGTGGGCCAAGAAATCCCCACTAAACAAAGAAGAGGTCCATAAATCTTTCTACAAGTACCTGAAGCCTTTGCAGTCCAAACTCTGAATGTCACGACGAGTTTATTCTGCCCCAGGAAGCAGCTGTACTCTGCTGCTCCCCTGGTACCTGCCACACAAATCTACGCGGAATCTTTATCGAATTCGGAGAGCTATAGAGCAAATGATAAATTGGCCCCTTTCCCATCTATAAATAAAAAAATGAACAGCTTACAGAAATTAAATGAAAAAAACATGTTTTTAAGTGCAATTAACACTGAAAGAGACCCGTTAAGCATTCAGAAAAAGCTTTGAGAAATGTACTCTGACTTCCATATGTACAGCTGCTGATCCCAGGAGGCCATAACTTACGATAATTAGTAAAACTTAACTACTGAGTAGTTAATTATTTTCACATCTTAATTGCACATCACTGGATATATGTGTTTTTAAGCAAAGGTATTTTTAAAAGGGTACAACCCTTCCAAGTTTTCCTGCTTAGTGTCCCTGTCACTACTGTCATGGGCCTTGGCTTAAAAGCAGGACCCGAGGCTGGATTGGGGGAAAGAAACCAATCAGAAACTTTAGTGTGAGTTTGTGCTTAACTCATCTTCTGCCTGCTTGCCCTTGGTTGCTGACATAATGTTTCTGTTTGTTCATAGTAGCATTTTTCCTACACAGGGATTTCTTCAGCACAGAGCTACTACAGGGTCATTGTCCTATGTGACTGGGAATCGATCTTCCACTCGAAGGATCCTAAAATTGTCACTGTAGTAGCACTGCAACTCCCTGTGTCCCCAACTTCTAGTGGAGGGGTAGGTAGCAAAGTTATCTCTACATAGGACTTTTGGCAGCTAATGGGACTCAGTCAGTGGTGTTTGATCTCCCTCCATCCCTGTCCCTTAACCTCTCCTGAAAGAGATGCCGGAGGAGAAGAGAGTCACAGTTCCCTCCTAGTAGAATATGTATAGGGAAAGCTCTCGGTTACGGTTACGGTAACTTTGGGTACCATAGTAACTGGTAGATTTCATATATTCTGTTATATTGGCATAAACCATTAAAATGCTTGGAAGTTACAGTACCTTGCATTAGGAAAGTAAAATCATATTTCAGGTTAACTCTTAGACCCAGGGGTAGCACAGAAAAATCTTTTGACAAACCATGTGTTCTGATTTTTGGATCAGAAAATATAATCTTTGAAGGATAAAGGATAAATGGGACTTCCATAGGATCTCTTTCTTTTTTTCGTTTAGGTGAGGCAACACCCTTGGTGGACCTCACAGATTGCAAGGAACTTGTCAGCTTACAATCCCTTATT