Transcript asmbl_31948

Sequence
Transcript Sequence for observation asmbl_31948 of TGE0004684:
CCGAGAAACAGGTACCTGGAGGCGGCGGCAGCGGCGGCGGCGGGGGCAGCGGTGGCGGCGGACGCGGTGCCGGAGGAGAGGAGAATAAGGAAAACGAACGGCCATCCGCCGGATCGAAGGCAAACAAAGAATTCGGGGATAGCCTGAGTTTGGAGATTCTTCAGATTATTAAGGAATCCCAGCAGCAGCATGGCTTACGGCATGGAGATTTTCAGAGGTACAGGGGCTACTGTTCCCGCAGACAGAGACGGCTCCGGAAAACGCTTAACTTTAAGATGGGGAACAGACACAAATTCACAGGGAAAAAAGTAACCGAAGATCTTCTGACCGATAACAGATATTTGCTTCTGGTTCTGATGGATGCTGAAAGAGCCTGGAGCTATGCCATGCAGCTCAAACAGGAAGCCAACACTGAACCCCGAAAACGGTTCCACCTGTTGTCTCGCCTGCGGAAAGCTGTGAAGCATGCCGAGGAATTGGAACGCTTATGCGAGAGCAATCGCGTGGACGCCAAGACCAAGCTAGAGGCTCAGGCTTACACAGCTTACAAAAAAAAAAGAACATCAAGAGTGGAAAGCTGCCATTGAGGCTTTTAATAAATGCAAAACGATCTACGAGAAGCTCGCCAGTGCTTTTACAGAAGAGCAGGCCGTGCTGTACAGCCAGCGTGTGGAGGAGATCTCGCCCAACATCCGCTACTGCGCGTATAACATTGGGGACCAGTCAGCCATCAATGAACTCATGCAGATGAGATTGAGGTCTGGGGGCACCGAGGGTCTCCTGGCTGAAAAATTGGAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGC