Transcript asmbl_31848

Sequence
Transcript Sequence for observation asmbl_31848 of TGE0024225:
CAGGACCTTTCTAGTTTGCATAGTAACCATCTTGTTTCTTTCACGACAGATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGTAAAATACAGCGGTGCGGAGGCGTCAGCTACGTGGAG