Transcript asmbl_31837

Sequence
Transcript Sequence for observation asmbl_31837 of TGE0004666:
CTCGCTGTCCGGCGGCGCCAACTGAAGCGCCGCTCCCGCTGCCGACATGCTGCGCCGCGTTCTGCTCTGCCTGGCCCTGGCCGCGCTAGGTCGCGCGGGCGCCGACCCCGACGAGGAGGACCACGTCCTGGTGCTGCACAAGGGCAACTTCGAGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGCGGCCACTGCAAGGCCCTGGCCCCCGAGTATGCCAAAGCGGCTGGAAAACTGAAGGCGGAAGGTTCCGAGATCAGACTGGCCAAGGTAGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTATGGCGTCCGCGGCTACCCTACGATCAAGTTCTTCAAGAATGGAGACACGGCTTCCCCCAGGGAGTATACAGCTGGCAGAGAAGCCGACGACATTGTGAACTGGCTGAAGAAACGCACGGGCCCCGCTGCCACCACACTGCCCGACGAGGCCGCCACAGAGGCCTTGGTGGAGTCCAGCGAGGTGACGGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTTTGCCAAGCAGTTCCTGTTGGCAGCGGAGGCCATTGATGACATACCCTTTGGGATCACGTCCAATAGTGACGTGTTCTCCAACTATCAGCTGGACAAGGACGGGGTTGTCCTCTTCAAGAAGTTTGACGAAGGCCGGAACGACTTTGAGGGGGAGGTCACCAAAGAGAAGCTGCTGGCCTTCATCAAGCACAACCAGCTGCCGCTGGTCATCGAGTTCACCGAGCAGACGGCCCCGAAGATTTTTGGAGGGGACATCAAGACTCACATTCTGCTGTTCCTGCCCGAGAGTGCGCCTGACCGCGACGGCAAGCTGAGTGGCTTCAAGAAGGCTGCCGAGCGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACGCCGACAACCAGCGCGTGCTCGAGTTCTTCGGCCTGAAGAAGGAGGAGTGTCCGGCCGTGCGCCTGATCACCCTGGAGGAGGAGATGACCAAGTATAAGCCAGAGTCAGCCGGGCTGACGGCAGACGAGATCACGGACTTCTGCCAGCGCTTCCTGGATGGCAAGGTCAAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTCA