Transcript asmbl_31574

Sequence
Transcript Sequence for observation asmbl_31574 of TGE0004630:
AGGTCACCATGGCTGCTGTTGGCTCCTTTGCTGTCCCCAGCTGTCCCCCAGGTCACCTCCCCTCCTTGCTGCCTGTGTCCAGAGAGCGTGCACAGGTTCCAGTGGATCAGAAACCTGGTTCCAGAGTTTGGAGTCTCCAGCTCTCACGTCAGGGTGCTGTCTTCTCCCGCAGAGTTTTTTGAGCTCATGAAGGGGCAGATAAAAGTAGCCAAGAGGCGGGTCGTGATGGCGTCCCTCTACCTGGGGACAGGTCCTTTGGAACAGGAGCTGGTGGATTGCCTGGAAAGCACTCTGGAAAAGTCACTCCAAGCGAAGTTCCCTTCAGACCTTAAGGTGTCCATTCTTTTGGACTTCACACGGGGATCACGAGGTCGGAAGAACTCTCGCACGATGCTGCTGCCACTCCTGCAGAGGTTCCCGGAACAGGTCCGGGTCTCCCTCTTCCACACCCCGGACCTCCGCGGCCTGCTCCGGCTCCTGGTCCCGGAGCGCCTCAATGAGACCATCGGCCTCCAGCACATTAAAGTGTACCTCTTTGACAACAGTGTCATCTTGAGCGGCGCCAACCTGAGTGACTCCTACTTCACCAACCGCCAGGACCGCTACGTGTTCTTGCAGGACTGTCCCGAGATCGCGGACTTCTTCACGGAGCTGGTGGACGCCGTGGGGGACGTGTCCCTGCAGTTGCAGGGGGATGACACGGTGCAGGTGGTGGAGGGTATGGTGCATCCTTACAAAGGTGACCGGGCTGCATACTGCAAGGCAGCCAACGAGCGGGTCATGGGTGTGGTCAGCTCGGCCCGGGCCCGCCAGCAAGCGCTGCATGCCCAGACTTTCCACAGCGACTCCCTGTTGACCCAGGAAGACGCAGCAGCCGCTGGTGACCGGAGGCCAGCCCCCGACACCTGGATTTACCCTCTGATACAGATGAAGCCCTTCGAGATCCAGATCGACGAGATTGTCACCGAGACCCTGCTGACAGAGGCTGAGCGCGGCGCCAGGGTCTACCTTACCACCGGCTACTTCAACCTGACCCAGGCCTACATGGACCTGGTCCTGGGCACGCGGGCTGAGTACCAGATCCTGCTGGCCTCCCCGGAGGTGAACGGTTTCTTCGGGGCCAAGGGGGTGGCGGGCGCCATCCCAGCGGCCTACGTGCACATCGAGCGGCAGTTCTACAGTGAGGTCTGCAGCCTCGGGCAGCAGGAGCGGGTCCAGCTGCAGGAGTACTGGCGGAGGGGCTGGACATTTCATGCCAAAGGTCAGTCCACCGGGACCTGGAGGCCCAGATCGCCATCGTGACGGA