Transcript asmbl_30543

Sequence
Transcript Sequence for observation asmbl_30543 of TGE0004593:
AGGTAATTCGGAGCTCTCAAAATGTTTGCCAAAGCAACAAAGAATTTTCTTAGAGAAGTTGATTCTGGAGGTGATCTGATTGCAGTATCGAACTTGAATGACTCTGATAAGTTACAACTTCTAAGCCTAGTGACCAAAAAAAAGAGATTCTGGTGCTGGCAGAGACCAAAGTATAACTTTTTATCTGTCACCCTTGGAGATGTGCTCATAGAAGACCAATTTCTGAGTCCAGTGGTCGTGGAGTCGGACTTTGTGAAATACGAGGGAAAGTTTAAAAACCACGTGAGTGGAACCATCGAGACGACACTGGGGAAGGTCAAGTTGAATATTGGAGGCAAAGGCCTTATGGAGAGTCAGTCTTCATTTGGAACCCTGAGGAAACAGGAAGTGGACTTGCAGCAGCTCCTCAGGGATGCCGTGGAGAGAACGATAAATCTGAAAAACCCTGTGCTGCAGCAGGTGCTGGAGAGGAAGAATGAGGTCCTGTGTGTCCTGATACAGAAGATAGCGACAACGCAGAAGTGCGTGATCTCTGAGCGCATCCAGGTTGAGGAGAAGTGCGGTGGCATCGTGGGGATCCAAACCAAGACGGTGCAGGTGCAGGCCTCCCGGGGCGGAGGTGCAGGCCTCTCGGGGCCAGAGGTGTCTGCTGCGGAGGATAGGGCTGTCACCAAGGACACCAACGTGGTGTTGGAGATCCCAGCTTCCACCACCATTGCCTACAGTGTCATCGAGTTGTATGTGAAAGTGAATGGCCAGTTCGAATTCTGCCTCCTACAAGGAAAGCATGGTGGCTTTGAGCAAGAGAGAAGAAGCAACTCTGTCTCCCCGAGCTCCCTGCCCTTTCAAGAGTTTGCGTTTAGCGACATGCCAGATGCCTGGCAGGGGCCGCCTGCCTCGGATAAGCCACTGAGTGTTTTAAAAGAAGTGACTCTGCCCTTGGAGAAGAGTTTCCGTCCCTTCGCAGAGCTGCCCGAGCAGCAGCAGACGGCCTTGAGCGGCATCCTGCAGGCGGTCCTGTTTGATGACGAGTTACTCCTGGCCTTGGAGCAAGTGTGTGACGATGTGTTCAGCGATCTGTCACCCCCACGGGTGATACCTGGAGAGCTGAAGCCCTCACAGCAGCAGGACCTCATGGCCTTCCTGCACCTGGTGGGGTACAGCATGCAGAGTGGGTGTCCGGGCCCGGAGGATGCTGTCAGCAACCAGAAGCTCTTCTCTACGGCCTACTTCTTGGTCAGTGCACTAGCAGAAATGCCAGATAATGCAGCAGCTCTTCTGGGCACGTGCTGTAAACTCCAGATTATTCCTACGCTGTGTCACCTGCTCCACGTGCTGTCTGCTGATGGAGAATCTGATCTTGAAGACGCAGCCCTGGCTCCTCTGAGAGATACAGAGAGGTTTGAGATTGTGCAGCGCCTGCTTGCTGCAGCTGACATTAACCTGGAGCGACAGCAGTCGTCCGTGAAAGCTGTCACCTGCCAAGTTCCTAACGTTTCCCCGCTCGTTCTTTATATAAGCCTGAATGGACTCTGGGCTTTAGGCAGAATGCATCAGTAACGTCACACGTGAATCATGAGGACATGTTCTCGGCCAAGGCTGGGTAACTTTCAGGATCGTTGAGATACTACTTTGGGGCCTAGGTCAGATCTATGTTGAAAGATGCTCAAGGAAATGAATTTACAAGAGTCTATGGAGTGGTAACTTTTTACGCTAGGAATCGCCTTGAGTTTAGCCACCAGGTACTCTGTTTCTGTTTCATACGAGGCCCTCCTGTGCTGGTCACCCCATGTGCAAGTTCAACTCCAGCACCCGAAGGCCTGGGGAAGGGATGAGAATTCTAAGCCAGAGTACATTCAGACCTTTTTTTTCTGGAGCGGCACTGAAAAAAATGGGTCCATCTATCACTTACATTTCCCTCTTTCTTCCTGTTGTACCAAAACAAATGGGTCTGCCACTTTGATCCAAAAATTCACTTTAAATTGTGAACGTTGTGGAAGGGCAATTTCTCTTCATAGAAGGCTACGTTTTGGACGTGCTATATGCCTTGCAGTGACTGAAAAATGAACTGTAAGTGCCACTAGAGCACATATATTCTTCTGCTAAACAAAATTATACTAGAAAAATCTAATAGCAGGGCACCTTTCCTTAAGGGTCTAGCTATATGCATTTTATTTGGCTTTGATGAACATAATAATTCTCTGTCAAGAACAATGTGCTAGTATCCCATACAATCTTGATGTTTAATTTGTAAAATACTACATCCCGTATCCAAGGAAACTCTGAACTGTGTGTATGTCGCTTTTTATTGTTTCCATATCCTTCTATAAATAGCCTGGACTGTCCCCTTGCTACTGGGGACCTGAAGCCAGCACCCTGCTTTCTGCCTTAGCAGAAAGTAGCTATCCCTCCTGCTAGAACCTGTCTGTCTTCAGGAGCATGGGGGTGAGGAGCCGCAGTTGTTGGGGAGAAACATTTCACTCGGTATTTTTTTTTTACCTCAATATCATCTACTTA