Transcript asmbl_3010

Sequence
Transcript Sequence for observation asmbl_3010 of TGE0004434:
CTTTTATAAAGGGCCACGCTGTCCCCCACTTGGAAGCAGCTTTTTGGCTCCTCCAGAGTCTGTCAGTTTCGGCTCCTCGCCTTCACTCCAGCCTCCAACATGTCCGTGAGGGTGACCCAGAAGACCTACAAGATGTCCACCTCTGGTCCTCGGGCCTTCAGCAGCCGCTCGTACTCGAGTGCTCCCGGTTCCCGTATCAGCTCCTCGGCCTTTTCCCGGGTGGGCAGCTACCGGGCTGGCCTAGGCATCAACATGAACCTGGCTGGGGGTTACGGCGGAGCTGGAGGTGCGGGGAACATCACAGCAGTCCAAGTGAACCAGAGCTTGCTGAGCCCCCTGAAGCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCTAACTTCATCGACAAGGTACGGAGCCTGGAGCAGCAAAACAAGATTCTGGAGACCAAGTGGAACTTTCTGCAGCAGCAGAAGACGATTCGCAGCAACATGGACAACATGTTTGAGAGCTACATCAACAACCTTCGACGGCAGCTGGACACGCTGGCCCAGGAGAAACTGAGGCTAGAGGCAGAGTGTGGCAACATGCAGGGGCTGGTGGAAGACTTGAAGAATAAGTATGAGGATGAGATCAACAAGCGCACAGAGATGGAGAATGAATTTGTCCTTATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTAACCGATGAGATCAACTTCTATAGGCAGCTGTATGAAGAGGAGATCCGTGAGCTGCAGGCCCAGATCTCTGACACGTCCGTGGTGCTGTCCATGGACAACAACCGCTCCCTGGACCTAGATGGCATCATCGCCGAGGTCAAGGCCCAGTACGAGGACATCGCCAACCGTAGCCGGGCTGAGGCTGAGACCATGTACCAGATCAAGTATGAGGAGCTGCAGACGTTGGCTGGGAAGCATGGAGATGACCTGCGTCGCACAAAGACAGAGATTTCTGAGATGAACCGGAACATCAGCCGACTCCAGGCTGAAATCGAGGCCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATCGCTGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCTCAGGCCAAGGTGGCTGAGTTGGAGGCTGCTTTGAGAAATGCCAAGCAAGACATGGCCCGGCAGCTGCGCGAGTACCAGGAGCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATCGCCACCTACCGCAAACTGCTGGAGGGCGAGGAGAGCCGGCTGGAGTCTGGGATGCAGAACATGAGTATCCATACCAAGACTACCAGTGGCTACTCAGGTGGGCTGAGCCCGGCCTATGGAAACCTCACAAGTCCTGGCCTCAACTACGGTGTCAGCTTCCAGTCCAACTTCGGCTCTGGGGGGAGTTCCGGCTCTTTCAGCCGCACCAGCTCCACCAAGACCGTGGTGGTGAAGAAGATCGAGACTCGTGATGGGAAGCTTGTATCTGAGTCATCTGATGTCCTGCCTAAGTAAATGGCTACCGTGGTCCCTCTTGGCCTTTCAAGCCTGTGGGAAAGGAGCTGTGCAGAGAGCCTTGAACACAGGAGACCCACCTGAAGCTCAGCCCCAGTTCTCAGCCCCAACCCTGGGTGGGGAATCTACTGCCTGGAGGACCGCCTCTTACCCACGCCCCTAACTAAAAGCCAAATCAAGTGTTTTTTCCAAAATAAAGTCTCAGCTGGCTCTGCCAACCTTAC