Transcript asmbl_28733

Sequence
Transcript Sequence for observation asmbl_28733 of TGE0004512:
CAGAGAGCGCAGCGCGGCGGCAGCAGGAGCCGAGTAGCGTGCAGAGCCGGTCATGGGCAAGTCAGCTTCCAAGCAGTTTAACAGTGAGGTCCTGAAGGCCCACAACGAGTACCGGCAGCAGCATGGCGTTCCTCCACTGAAGCTCTGCAAGAAGCTCAACCAGGAGGCCCAGCAGTATTCGGAGGCCCTGGCCAGCACGAGGATCCTCAAGCACAGCCCAGAGTCCAGTCGTGGCCAGTGCGGAGAGAACCTAGCTTGGGCATCCTACGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTACAACTTCCAGCAGCCTGGCTTCAACTCTGGGACTGGACACTTCACGGCCATGGTGTGGAAGAACACAAAGAAGATGGGAGTGGGGAAGGCATCTGCAAGTGATGGGTCCTCCTTTGTGGTGGCCAGATACTTCCCAGCAGGGAATGTTGTTAACCAGGGCTTCTTTGAAGAAAATGTGCTGCCTCCAAAGAAATAACTTGTCAAACATAATGGGAAGGTGGCAGACTTAAGAACGTGGTATGAAGTACCTAGAAGAACATTAGCTGTGTGTTTGTCCTTGTGGGTGTACATGCTTGTGTGTGATGCATGTGTGCATCTCTTGCACACATACTCGGATATACAGTTCTGTATGAACTCATTCTTGTCAAAAGAATGAGCATATGAAGGCTTTACTCTGATAGTTACCTAGACCACAATTATTTGGACTTTGGGGGCAAAATCAATTTTTAAACTTTTTTTTTCATTTTTTTAAGCAAACTACTTTTGTACGTTTCTTACTTTTAATATCCATCCCTGGACTTTTTATATTCCTCATGTTTGTGATACTGAGAACTGAAGTTCATTTTTTGTGATCTTCATACATTGTAATCTACTTGTGGTAGATATTTAAAAATATTAAACCTTCATTTAAATGTGACATAAAATGCAGCTTTAAACACATAAATATAAAGCAGCTTCCATGAGAAAACTGGTGTAGGCAGGAGTTCCATCTCACAGAATTACTGAGATTTCTCAGTTGTAAGACATGATGTCATCTGCATGCCTCCTGGAATTCTCTAATGGGATTGCCAAAGAACAAATGGAGAAGAAAACTTTACTTCTTTGCATTTTTCTACCTTTAAATAGCAAAGTACCACTACCACAACTACCCCTTGCCCCCTCCCCCATCTTTTTTCTTAAAATTCTCTGGCATTTCAGGGCTCAATATGTTTCCTGATTTCTGGAGAACTGGGCAAGGCCTGAAATTCACCCCTCCCCCACCTCTGCTGGGCGGCCCAGGACCCGTTCTGGGAGAGAGCCCCTCATACTGCCTGGGCTCTCAGCCAAGCGGCCTTGGATGGATGAAGTCAGTGAGTGTGGGGGAGAGGGTGAGCTCACTCAGGGCCCCCAGAGGAAGCTCTCCAGCCTCTGCCCTCCCCCTGACACACAGGGCGGGAGCCCGGGCTATTCGTGGCAGCTGTGGCTGCAGCTGTGCTGCTGTACCCTCCCAGAATGTGTGACAGGCCCAAATGTTCCTGGGAGATATCCCATGCGGGGCTTAGAGTCGCTAATTTGGTTCTGTGTTTTGCCTCAAACTGCACAAAGCTCCCCTAAACAACAATTTCGTATGGTGGGGGAGGGACCAATCCAGAGGCCAAGCTGAGTGTCCCTGAAACCATGGCATCTCCAGGTGGTAAGATAGCAGGAGCAGGAGTTAGGGAGTTACCTGCTTAAAGACTGGAGTCTGAGCAGGCCAGTCTGATACATGCTTCCCGAAGGTCTGTGTTGCACTGTGAACACAGTCTCATGCTGTGCCCTTCATTTCACCCAGAGATATTGACTAAGACAACAATAAAATCTTTTGTGTAATA