Transcript asmbl_28143

Sequence
Transcript Sequence for observation asmbl_28143 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTA