Transcript asmbl_26769

Sequence
Transcript Sequence for observation asmbl_26769 of TGE0004430:
CTGGGGTGGAGTAGGGGAAGCGGTGGAGAAGGGTAGGGTAGGGTAGCTGAGCAAGTTCGTTCACCTTAGTCCGACTCTTCGTCGTGAGAGAAGCTGGCCAAGGGGGCCGGGGCTTGCACTACACTTCCCGGGAGGCTGTGCGCAGCGGCGCGTCCCGTAACGGGAGCGCGGGCTTTGGAAGGCAGCGGAGCGAGAGGTGATCTGCGGCTGAGCTGAAGCGGTAGCGGGGCTGAGGACTGTCCTGGGCGACACCGGACCAAGCGCTAGCTGCCGAGGCCTCGTGCCCCTAGGCCAGCCGTTCCTCCTCCGTGTCGCTATGGGTATTCAAGGCCTGGCCAAACTGATTGCTGATGTGGCCCCCAGTGCCATCCGGGAGAATGACATCAAGAGCTACTTCGGCCGCAAGGTGGCCATCGATGCCTCCATGAGCATTTATCAGTTCCTGATTGCCGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATCCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTCGATGGCAAGCCGCCACAGCTCAAATCGGGTGAGCTGGCCAAACGCAGCGAGCGGCGGGCTGAGGCCGAGAAGCGGCTACAGCAGGCTCAGGATGTTGGGACTGAGGAGGACGTGGAGAAGTTTACTAAGCGACTAGTGAAGGTCACCAAGCAACACAATGATGAGTGCAAGCATCTACTGAGCCTCATGGGCATCCCGTACCTCGATGCGCCCAGCGAGGCAGAGGCCAGCTGTGCAGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCCACGGAGGACATGGATTGCCTGACCTTTGGCAGCCCTGTGCTAATGCGGCACCTGACTGCCAGCGAGGCCAAGAAGCTACCCATCCAGGAATTCCACCTGAGCCGGATTCTTCAGGAGCTGGGCCTGAACCAGGAGCAGTTTGTGGACCTCTGCATCCTGCTGGGCAGCGACTACTGTGAGAGCATTCGAGGCATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTGCGTCGACTTGACCCCAGCAAGTACCCCGTGCCGGAAAACTGGCTCCACAAAGAGGCCCAGCAGCTCTTCCTAGAGCCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGTGAACCAAACGAAGAAGAGCTCGTCAGGTTCATGTGCGGCGAAAAGCAGTTCTCCGAGGAGCGAATCCGCAGTGGGGTCCGGCGGCTGAGCAAGAGCCGCCAGGGCAGCACGCAGGGCCGCCTGGATGATTTCTTCAAGGTGACCGGCTCGCTCTCGTCAGCGAAGCGCAAGGAGCCCGAACCCAAGGGATCCGTGAAGAAGAAGGCGAAGACTGGGGCGGCAGCAGGGAAGTTTAAGAGGGGAAAATAAACAAGTTCCCCTTCAGTACACCTCCGTGCCCAGAGTTATCTGCCCCGTCCCCTTGAGGGCTGGCACTGGAGAAGCCTCCCCTGGGGCAGGGAGGGGACTGCGTTGCTTCTGTGGCATGCGCCTTCTCAGTACTGCAGTTCCCTTTTTTACTTGATCTTATGGCAGGAAAGCCGCAGAGGTACTTTGTTTTCTTCTTTTTTTAGCTCAGGAAAGTATGTCAGCCTCAAACTACCTTTCACTTTAATGGACACTGAATTCATTGTTACGTAAAAGTGATAGCAACAGGTTTTGAAGAAGGGAGAGGGAGAGAAATGGTGGAGACAAAAGACTTTACAGAAGTGATTTCCTGGCTGGCCAGCCGGTGGCCGGTGATGGCGGAACCAGACCACGCTTCTCTGGTTCAGCCTTGACCCACCATGAAGGAAGGACAGCCGGCAGGAAGACCCGGTCTTAGCAAATAGGAAGAGCTACTAAGAAATAAGACAGGCAGAGAGCTGGAGTACATGGACTTGGCAACAAGGGTTCGATTACTGGCTGTGTGTCCTGGGGTGGGCAGAAACTTGAACTTGCTGTGTAACTTGAGTCTTTAGTCATTATTTAGAGGCATAAGGTGGTGAAGTTCTTCTCATGGCCTTTCTGAGGCAATCAACTGAGTCGAGACTTTGGGAAAAGATGCTGTTATGTTTTTGTTTTAAGGTTATGAGAAAAGAGTCAATAAAATTATAAAAGTAA