Transcript asmbl_26762

Sequence
Transcript Sequence for observation asmbl_26762 of TGE0004427:
GGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGTAAAGTGCAGCTTCCTGACGTGGAGACTTAGCTTAACCAATTAGATCTAGAAATGGAAAAAGCCTACAGTCTGTCACTCGTTTCGTTGCCTTGATCAATAAGCACCCGAATGTGTGGCGAGGGGCGGATTCCACAGTGACAGAGAAATCACAGCTGGGGGCCGCCGGGCTTGCTGGCGCCTACGACTCAGGTCGTTCAACGAACCTGCGTTGTGACGACTGAGGTGCCCGTTGCTGGGCTGACCCAAGCCTCATCTCTCCCTGCCCTTTGTTTCCCAAAAGGCCGGGGTCTGAGCTCCCGCAGATTGTCCTGAGTTTCCGGTCAGTGGACTGACCGCATCCTCCCAGACCTCGTTGCACAGATACCTCCACTTTAAGAATTCTTTCACTTTGTTCACAAAACAAAGAAACCACAACAACCCTCCCTCCCCACCCCATCACCCAGAAATCCCCAAGCAACCAACCAACGAAAACCCAGCTGGTCTCCGTCTCCCTCGTTTCCTTCTAGAGAGTCGCTCTCCTAAATAAATACCTTAAGCTCGATGACTGACTCCCATCGCCCTTTTTCTGGCACAATCCCATCCTCGGATGGCCCGAGTCTCAGCCTTGCGCGACCACACGGCTCAGGCGGGCTGGAGGCCATACCCCATAGCGGTCCAAGGGTGGTACCGGACCTTCGAAACGGCCCCCACGCCAGATCGGCCACAGCCGTGGTCCAGGGGTCATCGACGTGCGTGTGCCTCCGGTGAGAGCGCAG