Transcript asmbl_26702

Sequence
Transcript Sequence for observation asmbl_26702 of TGE0004418:
TGGAAATTGAAGAACGGAGATGGGGACCAGGAGGGAGGGAAGGACTGGGGGTGAGCAAAGGGGCGGGGCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACAAA