Transcript asmbl_26687

Sequence
Transcript Sequence for observation asmbl_26687 of TGE0004413:
GTCCCTCTGCAGCTTAGTGCTCCAGCCCCCGCCTCCTGCAGCAGCCCGGTGGGGGGTGGGGAGGCGGGACCGGGTGGCGAGGTTGTGGTCTCAGGGCCGGGCGTGGAGCTGACATTATGTACGTCCTGGCCCACTGTGCCAGCTCGGTACCTGTCCGGGCAGTTGCCATCCATTGTGCGACAGCGGCGGCAGCCAGAGCGTACCTGGAAGGAGGTCTACAGTGGACGCTTGGCAAGGCCCGCGGTTTCAGAAGCGCCGCTGCAGCTATGGCCCCGATCAAGGTGGGAGATACCATCCCGTCTGTGGTGGTGTTCGAAGGGAAGCCTGAGAACAAAGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAGGGGGTGCTTTTTGGAGTCCCTGGGGCCTTTACCCCCGGTTGTTCCAAGACCCACCTGCCAGGGTTTGTGAATCAGTCTGGGGCTCTGAAGGCCAAGGGGGTCCAGGTGGTGGCATGTCTGAGTGTTAACGATGTCTTCGTGACTGAAGAGTGGGGACGAGCCCATAATGCAGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACGGATTTGTTGCTAGATGATTCATTGGTGCCCCTCTTTGGGAATCGACGGCTCAAGAGGTTCTCCATGGTGATCGAAGATGGTGTAGTGAAGGCTCTGAACGTGGAGCCGGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCGCAGCTCTGAGGCCCTGGGCCCAGATACACTCCTACCCTTTTTTGTTTCACCTGCCCAGCTAAAGGCAGAGGGCCCCAGCCCAGCCTCAGCTAGGGCCACCCGATTGGAACTTTGGCTAGATTTCTTCAATAAACACTTTTGGTTCA