Transcript asmbl_26676

Sequence
Transcript Sequence for observation asmbl_26676 of TGE0004412:
CCGGGACTGAAAACGGCTGCCGGAGGGGGCTACGGGGATCATGGGCCTTTTGACCATCCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCCTGGACAATGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAGGACATCGACACCATCTCTCCAACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGGGGATTCAAGCTGAACATATGGGATGTGGGCGGCCAGAAGTCCCTGCGCTCCTACTGGCGAAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCTGACCGCCAGCGCATGCAGGATTGCCAGCGCGAGCTCCAGAGCCTGTTGGTGGAGGAGCGCCTGGCCGGAGCCACCCTCCTCGTCTTTGCCAACAAGCAGGACCTTCCCGGAGCACTGTCCTCTAATGCCATCCGTGAGGCCCTGGAGCTGGACTCCATCCACAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACTGGGGAGAACCTGCTGCCCGGCATTGACTGGCTCCTGGATGACATTTCCAGCCGCATCTTCACGGCCGACTGAGCCGCTCCAGACGCCCCGACATCACAGTCTGGGTCGTCCCTTCTACCCCCTGGCCCTCACCAAGCACCATCCGTGGGAGGATGGGAATCAGCCAGCCCAACTAACACTCCCCAACCCCTCCGTAACCTGCTGCCGCCGCCCGCTGCTGCTCCGTGGCCAGCCAGCTCCCATGACAGGAGGGCTGCCCTCCTGGCTGTCACCCTGGCTCCTGACCTGGCCCTGCAGCTGCCATACCAAGAGGTGAGGGTTGGGGCTGGGCGGGGGCTGTCTCTGCTGCTATGGAGGCTGTGGGCCTCGTCC