Transcript asmbl_26655

Sequence
Transcript Sequence for observation asmbl_26655 of TGE0024061:
CCGGGCCTCCCGGCCTGAGGGAGAGGAGCAGGGAAGATGGCGGCTGTGGTGGAAAATGTAGTGAAGCTCCTGGGGGAGCAATACTATAAAGATGCCATGGAGCAGTGCCACAATTACAATGCCCGCCTCTGTGCTGAGCGTAGTGTGCGCCTGCCTTTCTTGGACTCACAGACCGGAGTAGCCCAGAGCAACTGTTACATCTGGATGGAAAAACGACATCGGGGTCCAGGTTTGGCCTCTGGGCAGCTGTACTCCTACCCTGCCCGGCGCTGGCGGAAAAAGCGGCGAGCCCACCCTCCTGAGGACCCAAGACTTTCTTTCCCATCTATTAAACCAGACACAGACCAGACCCTGAAGAAGGAGGGGCTGATCTCTCAGGACGGCAGTAGTTTAGAGGCTCTGTTGCGCACCGACCCCCTGGAGAAGCGAGGTGCCCCAGATCCCCGCGTCGATGATGACAGCCTGGGCGAGTTTCCTGTGACCAACAGTCGAGCACGGAAGCGGATCCTAGAACCAGATGACTACCTGGATGACCTTGATGATGAGGACTATGAAGAAGACACTCCCAAGCGTCGGGGCAAGGGGAAATCGAAGGGTAAAGGTGTGGGCAGTGCCCGTAAGAAGCTGGATGCTTCCATCCTGGAGGACCGGGACAAGCCCTATGCCTGCGACATCTGTGGGAAACGTTACAAGAACCGACCAGGCCTCAGTTACCACTATGCCCACTCCCACTTGGCTGAGGAGGAGGGCGAGGACAAGGAAGACTCTCAGCCACCCACCCCGGTTTCCCAGAGGTCCGAGGAGCAGAAATCCAAGAAGGGTCCCGATGGATTGGCCTTGCCCAACAACTACTGTGACTTCTGCCTGGGAGACTCAAAGATCAACAAGAAGACAGGACAACCCGAGGAGCTGGTGTCTTGTTCTGACTGTGGCCGCTCAGGGCATCCGTCTTGCCTGCAGTTCACCCCCGTGATGATGGCAGCCGTGAAGACCTACCGCTGGCAGTGCATTGAGTGCAAGTGCTGCAATATCTGCGGCACCTCTGAGAATGACGACCAGCTGCTCTTCTGTGATGACTGCGATCGTGGCTACCACATGTACTGTCTTACCCCGTCCATGTCTGAACCCCCTGAAGGTAGGTTGCCCGGATCTTTCACTCAGCAATTATTTTAGTAACTTGGACCATCACCTGAACAATAAGTGAGTGGTGATAAATCC