Transcript asmbl_26513

Sequence
Transcript Sequence for observation asmbl_26513 of TGE0004390:
CGGGTCTGGGACCCACCGCACCTCCCGTGCTTTTCATGCTGACAGATGCGCTGCCTGACTACACCCACGCTGCTTCGGGCCCTGGTCCAGGCCGCACACACAGGGCATTCTAGTGGCCGGAGCCTGCACAGCGGCGCAGTGGCAGCCACCTATAAGTACGTGAACGCGCAAGAGCCCTCCATGGACATGAAGTCGGTGACTGACCGGGCAGCTCAGACCCTGCTGTGGACGGAGCTCATCCGAGGCCTGGGCATGACCCTGAGCTACCTGTTCCGGGAGCCAGCCACCATCAACTACCCGTTTGAGAAGGGCCCGCTGAGCCCGCGTTTCCGCGGGGAGCACGCGCTGCGCCGTTACCCATCCGGGGAGGAGCGCTGTATCGCCTGCAAGCTTTGCGAGGCCGTCTGCCCCGCCCAGGCCATCACCATCGAAGCCGAGCCTCGGGCTGACGGCAGCCGCCGGACCACCCGCTACGACATCGACATGACCAAGTGCATCTACTGTGGCTTCTGCCAGGAGGCCTGCCCCGTGGACGCCATCGTCGAGGGCCCTAACTTCGAGTTCTCCACGGAGACGCATGAGGAGCTGCTGTACAACAAGGAGAAGCTGCTGAACAATGGGGACAAGTGGGAGGCTGAGATCGCTGCCAACATCCAGGCCGACTACCTCTACCGGTGACACTCCTGCCCGGCTGGCCCGCAGCCCCTGCTGCCCAATAAAGAAGCTCTGCTCTCCCCCA