Transcript asmbl_26364

Sequence
Transcript Sequence for observation asmbl_26364 of TGE0004373:
GCCCTTTCCTGCCAGGTTGCATTCTGGGAAAGGGCCGTTTCCGTTAGGTACAGGAGGCTGAGGCGCGCGACCCGCCGCAGTCCCACGTGAAGGGCTACGCGAGCATCGCTCGGCGGGACAGCTCCCCGCTCGCCGCGGAGCGTCCCGGAAGCAGCGGGGAACCGGAAGTGGCCCGCGGCAGCTCAGAAGCTGATCCCGGTTCCCGGTGTGTGGCCCCTCGAAGCGCAGCGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGTGTGTCCCCTGTCTCTAATCATGTCTATGAGCGGCGGCTCATTGAAAAGTATATTGCAGAGAATGGCACAGACCCCATCAACAACCAGCCTCTGTCCGAAGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCCTTACAGGACGAGTGGGATGCAGTTATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCCCACGCGCTGTACCAGCACGACGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCAGAGAAGCTCTGGCTACCCTGAAACCGCAGGCTGGTCTCATCGTGCCCCAGGCTGTGCCGAGTTCACAGCCAAGTGTTGTGGGTGCAGGCGAGCCCATGGATTTGGGTGAACTGGTGGGAATGACTCCCGAGATCATACAGAAGCTCCAAGATAAGGCCACTGTGCTGACCACGGAGCGTAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTTAGCAAATACCGTCAGGTGGCATCGCACGTGGGCTTGCACAGTGCCAGCATTCCCGGGATCCTCGCCCTGGACCTCTGCCCCTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAACGTCGTCGTCTTTGACAAGAGTTCTGAGCAGATCCTGGCCACCCTCAAGGGCCACACCAAGAAAGTCACCAGTGTGGTGTTTCACCCTTCCCAGGAGCTGGTGTTTTCTGCCTCCCCAGATGCCACTATCAGGATTTGGTCTGTCCCGAACGCCTCTTGTGTACAGGTTGTTCGGGCCCATGAGAGCTCTGTGACCGGCCTCAGCCTCCACGCCACTGGCGACTATCTCCTGAGCTCCTCTGATGACCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTACTCACCAAGGTGACAGATGAGACCTCTGGCTGCTCTCTCACCTGTGCGCAGTTCCATCCCGATGGGCTCATTTTTGGAACGGGAACCATGGACTCTCAGATCAAGATCTGGGACTTAAAGGAGCGCACCAACGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACCAGCATTGCCTTCTCCGAGAATGGCTACTACCTGGCCACCGCGGCCGACGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACACTGCAGCTGGACAACAACTTTGAGGTGAAGTCGCTGATCTTTGACCAGAGCGGTACCTACCTGGCCCTTGGGGGCACAGATGTCCAGATCTACATCTGCAAACAGTGGACGGAGATTCTTCACTTCACAGAGCACAGCGGCCTGACCACAGGGGTGGCCTTTGGGCACCACGCCAAGTTCATCGCTTCCACGGGCATGGATAGGAGCCTCAAGTTCTACAGCCTGTAGGCCCTGTCCCCTCTGACGCAAGCTGAACCTCATCTCAGTAGTGGGGTAGAGTTAGGG