Transcript asmbl_26270

Sequence
Transcript Sequence for observation asmbl_26270 of TGE0004349:
GGGGCACGTTGGAATCATGTGTGGGTCGGCACCGAGACTGGGATCCTGAAAGGGGTGAATCTTCAGCGCAAACAGGCCGCGAATTTCACGGCGGCGGGACAGCCGCGGCGGGAGGAGGCGGTGAGCGCCCTGTGCTGGGGCGCGGGTGGTGAGACACAGATCCTTGTGGGCTGTGCTGACTCGACCGTGAGGCACTTCAGCACCGAGGATGGCAGATTCCAGGGCCAGAGGCACTGCCCCGGCGGGGAGGGCACTTTCCGAGGCCTCGCCCAGGTCGATGGCACCCTTATCACATGTGTGGATTCTGGGATTCTCCGAGTCTGGCGTGACAATGACAAGGAGATATCAGCTGATCCACTCCTGGAACTGAGGGTAGGCCCTGGGGTGTGTAGGATGCGCCAAAACCCAGCGCGCCCTCATGTAGTTGCCACAGGTGGGAAGGAGAATGCTTTGAAGGTGTGGGACCTCCAGGGGTCTGAGGAGCCTGTGTTCAGAGCCAAGAATGTACGGAATGACTGGCTTGACCTGCGAGTTCCCATCTGGGACCAGGACATACAGTTCCTCCCTGAGTCGCAGAAGCTTGTCACCTGTACAGGGTACCACCAGGTCCGTGTCTATGATCCAGCCTCTCCTCAGCGCCGGCCGGTCCTAGAGGCCACCTATGGAGAGTATCCACTGACAGCCATGACTCTCACTCCTGGGGGCAATTCGGTGATCGTGGGGAACACTCACGGGCAGCTGGCAGAAATCGACCTTCGGCAAGGACGTCTACTGGGCTGTCTGAAGGGGCTGGCAGGCAGCGTCCGTGGGTTGCAGTGCCACCCTTCAAAGCCCCTACTAGCCTCCTGTGGCTTGGACAGAATCTTGAGGGTACACAGGATCCGGAATCCACGGGGCCTGGAGCATAAGGTTTATCTTAAGTCTCAGCTGAACTGCCTTCTCCTGTCAGGCAGGGACAACTGGGAGGATGAGCCCCAAGAGCCTCAAGAGTCCATCAAGGTGCCCCCAGAAGACACAGAGGCAGATGAACTTTGGGCTTCTTTGGAGGCAGCTGCCAAGCGGAAGCTCCCTGATTCGGAGCTGACCCCAGGGTCTCGGCCAACCAGACGGAGAAAGAAGCGGCCTGGCTCCGCCAGCCCCTGAAGAGCCTGTGCTCATTTTGTAAATAAACAG