Transcript asmbl_26000

Sequence
Transcript Sequence for observation asmbl_26000 of TGE0000661:
GAGTAGCTTTCTCTGAGGAATCCAGCATCATCCGGCTGTCGGAGCCATCCTGCAGTCTGAGACTCGACTTCTGTGCTCTGAGAGGATGCCGGGGCCCGCCTGGGCCGGGCGTACTGGCCTTGCGGGGACCTGGGCAGGCGTAGGGGAGGGTCATTCTCGGCCGCCCCACGCTCCGTATCCTGGAGAGCCCGGCCGGCCTCTGGGTCCCAGGCCGCAGCGCTAGCGGGAACAGGAGCTTCCGACCGCCCGGGGAGGCGGCGCCAGGACCTTCCCGTAGTGGCTGAGGCAGCGCCTTGGCGGTGGGCGGCATCGGGGACGGTGGGCGCCGAGGGCCGTGCAGCTTCCAGTTGCTGCGGACGCTCGGCCTGGCGTGGCGGATTGCTCGGACCTAACCGGCATCATCGTGCTCCGGGCTCTCCCCTCATGCACTATCGGGCGAGAGGAAGCAGGTCGGCTCCCGGCTCCCGGCTCCCGGCTGTCGGCGTCCGGAGCCTGCTCTGGGCTGAACCCTTAACGTTCAGAACTTTTCAGACTATCACAGTGTCTTGCAGTTCGTGCCCGTTGGGCTGGTCTGTTCCGGCGCACGTAAAATGTTTATTTGCCACTGTTGTGCACTTGCTATTGGATACAATCTTGGCGCAAAGACGGGCGATTTAGTAGTTTTGGGTGTTCGGTGACAGTTACTCTTTCGGATATTCGGACAAGGCTGACGTTGAGTTAGTTGGGTCGAAGGACCATGTTAATATAGTACAGTTGCTGCTGGATTTTCAGACGTTTGCGAAACGTCGGTGATTCGGCTCCCGTTCTGATAACTGACAGGCCGTAGCTGATATTTTTGTTTTGGTAGCTGGGGATACTGGGGGGACCAGTGTGCTTAGAGATAGGAAAACTTCGCGATGACAGAGGCAGAAAAAAAGATGTGTTCTCACAGTGGAACGATGGGGTGCCTGTTGACAATGACGGTAAAGCCGTGTCCTGTCTTCCCCAACAGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGAC