Transcript asmbl_25999

Sequence
Transcript Sequence for observation asmbl_25999 of TGE0000661:
TTTTTTTTGGCGGTACTTTGAAAATCTCGCGATAGCTTGTCCGCTTCCCATAACTCCGTGTGCTCGCCCCTCCCGTCCTCTTTCCGCCATCTTTCCGTGCCGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGACTCTGGTGCTTCGCTCGGTCGTTTTGAACTTGACAGCAGAGTAGCGAGAGCGTCTGCGGCAGTGCAGCCTTTGCGTTAATTGGCGAAAGCCGTGTCCCTGAAGTGAA