Transcript asmbl_25756

Sequence
Transcript Sequence for observation asmbl_25756 of TGE0023975:
CCTCAGTCGCCGCCGCTGGGGCCGCCACCGCCCGTCCTCGTCGCCCGAGCCCGGACACCATGCCACAGGAAGAGTGACCTCGTCCCTGTTTTCACGATGGAGGACTCGGGAAAGACATTCAGCTCTGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCTATGACCTACAAGCAAAAGGCAGAGAATACACAAGAGGAGCTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAGACCAGGAACAGGGACCTCCTGTCAGAAAATAACCGCCTTCGCATGGAGCTAGAAACCATCAAGGAGAAGTTTGAGACACAGCATTCTGAAGGCTACCGTCAGATCTCTGCCTTGGAGGGCGACCTCGCCCAGACCAAAGCCATCAAGGACCAGCTGCAGAAGTACATCCGTGAGCTGGAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTAAGGGACTTTCTTTGCCTCACAGAGCTTTCCTCGGTGAGGACCCGGCGTGAGTCCCGG