Transcript asmbl_6742

Sequence
Transcript Sequence for observation asmbl_6742 of TGE0003333:
AAAAGTCTGTGAGGCGGGGCCGTAGGCAGCCTAAATCAGGCATCGGCGCGGTCAGCCTCGTGGCGCGCCCACGCCCCCACGCCGGCTCTTCCCGGGGTCCTTCCGTGCGCGTTGATATGATTGGCCGGCGAATCGTGGTTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGATCACAGCCGAAGGAGTAAAGGTGCTGCAATGATGTTAGCTGTGGCCACTGTGGATTTTTCGCAAGAACATTAATAAACTAAAAACTTCATGTGTCTGGTTGTTTGAAA