Transcript asmbl_6739

Sequence
Transcript Sequence for observation asmbl_6739 of TGE0003332:
CCGGGGGCAGCGGCGGGGTCCTGTCTGGGAGAGGACAGGGTTGCGGCGGGCGGAACGGTGTCTCCTTCACTTCGCCCTCCAGCTGCTGGAGCTGCAGCCCGACCGCGAGCGTGCCAAGCGGCTTCAGCAGCTAGCGGAGCGGTGGCGGCGGCCCCCCTCAGGACACCACCAGATTCCCCTCTTCCCGCGGCCTCGCCATGGCGACCCACGGACAGACTTGCGCGCGTCCAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAATCCAGCTGAAAGAAACCTTTGGGAATGGATATCAGAAGATTTGGCCTTAATATATTTCCATTGTGACCAGCAGCAGGCTTTTTTCCCCCAAGAAGATGATCAAAACAAAGGATGATCTCAACAAGAGCTGTATTTTAAGTATTTAGACAGTTCTTTGTTAGCTGGTTTCTAGTTGGTTATCTAGTTACCAATGCTGCAGTCCTGCAGTCACCTATACATTATTTAAATGTATTTAACTGTTAAATGCGCTACCCACCAATAATGAAATAGACCTTTATGAAAACTGTGCAATTGTGTGCATGTTTGTTTTTATGTTCCTTTAGAAAACATTGACTGTTACCATTGAATGAGATGGATCAGTGGATATTAAGATGAGGTTACAAATTTTGTTAAGTTCAGCCATTATTACTTTTGGTATCCCAGAACATGACAAATTATG