Transcript asmbl_2510

Sequence
Transcript Sequence for observation asmbl_2510 of TGE0004118:
CAGAGCCTGGCTCAGCTAGAGAATCTGTGCAAACAGCTGTATGAAACCACAGATACAACCACTCGACTCCAGGCAGAAAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTACTCCTTGAAAGAGGAAGTTCATCGTATTCCCAGTTACTGGCAGCTACATGCCTTACAAAGCTTGTATCACGCACAAACAACCCTCTACCATTGGAACAACGAATAGATATTCGAAATTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCTACTTTTGTGACACAAGCACTAATTCAGTTATATGCCAGAATCACAAAACTGGGCTGGTTTGACTGTCAGAAGGATGACTATGTCTTCAGAAATGCAATCACAGATGTCACAAGGTTTTTACAGGATAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTAACCAATGAAATTAATCAAGCAGACACCACCCATCCTTTAACCAAGCACAGAAAAATAGCCTCTTCTTTCCGAGATTCATCATTATTTGACATCTTCACACTTTCCTGCAATTTACTAAAACAGGCTTCGGGAAAGAATCTAAACTTGAATGATGAAAGCCAGCATGGTTTACTCATGCAACTGCTCAAACTCACTCATAACTGCCTAAACTTTGATTTCATCGGCACTTCTACTGATGAGTCCTCAGATGACCTGTGCACAGTACAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCAACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATCCCTCCTTCATTTTCACCCCTGGTATTATCCTGCTTAGTACAGATTGCCTCAGTTAGAAGATCCCTGTTTAACAATGCAGAGAGAGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTTTGCAGACTACTGGCCCGACTGAAGAGTAACTATCAACTGGGAGAGTTAGTAAAGGTGGAAAACTACCCTGAGGTCATCCGATTGATAGCTAACTTCACAGTGACCAGTCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTGCCATACGTGAAAGCCACAGAGCCCCACATGCTGGAAACTTATACTCCTGAAGTCACCAAAGCCTACATCACATCCCGTTTGGAATCTGTGCATATCATATTGAGAGATGGACTGGAAGATCCTCTGGAGGATACAGGTCTGGTCCAGCAGCAGTTGGACCAGCTGTCTACAATTGGACGTTGTGAATACGAGAAGACGTGTGCGCTCCTCGTGCAGTTGTTTGACCAGTCGGCCCAGTCCTATCAGGAGCTGCTACAGAGTGCCAGCGCAAGCCCAATGGATATTGCAGTGCAGGAAGGGAGGCTGACATGGCTGGTTTACATCATTGGCGCAGTAATAGGTGGCCGGGTCTCTTTTGCCAGCACTGATGAGCAAGATGCTATGGATGGCGAGCTTGTCTGTCGGGTGCTCCAGCTGATGAACCTAACAGATTCTCGCTTGGCTCAGGCAGGCAACGAGAAGCTAGAACTGGCCATGCTGAGCTTTTTTGAACAGTTTCGTAAGATCTACATTGGGGACCAGGTGCAAAAATCCTCTAAGCTGTACCGACGACTCTCAGAAGTTCTGGGCTTAAATGATGAGACCATGGTCCTGAGTGTCTTCATTGGAAAAATCATCACCAACCTGAAGTACTGGGGCCGCTGCGAGCCAATCACCTCCAAGACGCTACAGCTTCTCAATGACCTCTCCATTGGATACAGTAGTGTAAGGAAACTAGTGAAGCTTAGTGCGGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACGACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCACTCACAGCAGCGTTTGAGGCTGTAGCCCAGATGTTTAGCACGAATAGTTTCAATGAGCAAGAGGCGAAGCGAACTCTAGTTGGCCTAGTAAGAGACCTGAGAGGAATAGCTTTCGCCTTCAATGCCAAGACCAGCTTCATGATGCTGTTTGAATGGATATACCCATCCTACATGCCAATTCTCCAGCGCGCAATTGAGCTATGGTACCATGATCCAGCCTGTACCACACCCGTGCTCAAGCTGATGGCTGAATTAGTTCATAATAGATCCCAGCGACTCCAGTTTGATGTCTCTTCCCCCAATGGCATCTTACTCTTCAGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTCCCAAAGGATCAGGTCTATGCACTGAAGCTCAAGGGCATCTCCATCTGCTTCTCTATGCTGAAGGCTGCTCTCAGTGGGAGTTATGTCAACTTTGGAGTCTTCCGTCTCTATGGAGACGATGCCCTGGACAACGCTCTCCAGACCTTCATCAAGCTGCTCCTCTCCATTCCCCACAGCGACCTCCTGGACTACCCCAAGCTCAGCCAGTCTTACTACTCACTGCTGGAAGTCCTGACCCAGGACCACATGAACTTCATTGCAAGCCTGGAACCTCACGTCATCATGTATATTCTCTCTTCCATATCTGAAGGACTCACTGCACTTGACACCATGGTTTGTACAGGCTGCTGCTCCTGCCTGGACCACATCGTGACATACCTCTTTAAGCAGCTGTCACGTAGCACCAAGAAGAGGACAACACCCCTGAACCAGGAGAGTGACCGCTTTCTGCATATCATGCAGCAGCATCCAGAGATGATCCAGCAGATGCTGTCAACGGTGCTGAACATCATCATCTTCGAAGACTGTAGGAACCAGTGGTCTATGTCCCGACCGCTACTGGGCTTGATACTACTTAATGAAAAGTATTTTTCTGACCTAAGGAACAGTATCGTGAACAGCCAGCCACCAGAGAAGCAGCAGGCTATGCATCTGTGTTTTGAAAACCTGATGGAAGGCATAGAGCGAAATCTTCTCACAAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAAGTCAACGACTCGATGAAGAACTCCACTTACGGCGTGAATAGCAATGACATGATGAGCTGACACCTCCTTGGAATCTACCTGTACAGAGCAGCGTCCCTTCGGTCTGGCCCAGAGGGGCGAACAATTACAAGGGAGAGGGCCTGGCTGATCCTGGCGCCCTTCTCCAGGGGTGTGGAGAAAATGGCAAAGGTCAACTAGCTGTTTCCCCAGGGAATAGGGGTGTGAGTGCAC