Transcript asmbl_24601

Sequence
Transcript Sequence for observation asmbl_24601 of TGE0004263:
GGGGATGTGTGTTCACTTAGCACGGACTTCTGGGAGGGGCTAAGGAAGGGCGGTCTGGAGTTTTATTGAATAGAGCAGTGTGTATGAGGCTGCCTGCCTGCCTGCCCTCTTGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTGTCCGACTTAGTCCTAGGAAGAAGTTTCAGCCTACGAGATATCATTAAAACATTCCAAGATCATCCAGTCGAATTCTACAGGGATTGGCGATCAACCGGAACACTCTGACGTGGATATCTGATTGCTTACCTGTCCAGACATCATCTGGTCTCCTTAAACCTGAAACCACACCATGGATGACTTTGAACGTCGCAGAGAACTTAGGAGGCAAAAACGGGAAGAGATGCGCCTGGAAGCAGAAAGAATCGCCTACCAGAGAAACGACGACGATGAGGAAGAGGCCGCCCGGGAACGGCGCCGCCGAGCCCGACAGGAAAGGCTGCGGCAGAAGCAAGAGGAAGAATCTTTTGGGCAGGTGACTGACCAGGTGGAGGTTAACGCCCAGAACAGTGTGCCTGACGAGGTCAAGACAACCACGGCGAACACTCAGGTGGAGGGCGACGACGAGGCCGCGTTCCTGGAGCGCCTGGCTCGGCGGGAGGAGAGACGCCAAAAACGCCTCCAAGAAGCTCTGGAGCGGCAGAAGGAGTTCGACCCCACAATAACGGATGCAAGTTTGTCGCTACCAAGCAGAAGAACGCAAAACGACACAGAAGAAAACGAACATGCAGAGAAGGAAGAAATCAGTGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAATAGTCACGAAGTCCTACCAGAAGAACGACTGGAGGGTTGCTGAAGAGAACAAGAAAGACGAAAAAGAAAAGGAGGGAGAGGAAGAAGAGAAGCCAAAGCCAGGGAGCATCAAGGAAAATCAGATCAAAGATGAGAAGATGAAAAAGGACAAAGAGCCCAGGGAAGATGTTAAGAGCTTCTTGGATGGAAAGAAGGGATTCACAGAAGTCAAGTCGCAGAATGGAGAATTCGTGACCCACAAACTTAAACACACTGAGAATACTTTCAGCCGTCCCGGAGGGAGGGCTGGCGAGGCCAAGGAGGCGGAGGGCGCGTCCCAAGTGGAAGCGGGCAAGCGCCTGGAGGAGCTGAGGCGCCGCCGTGGGGAAACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCAGCAGGAGGCAGCCCTGGAGCTCGAGGAGCTGAAGAAAAAGCGGGAGGAGCGAAGGAAGGTTCTGGAGGAGGAGGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAAGTCAGAGAGGAGGAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGGGCAGAAGCTGCTGAGAAACGCCAGAAGATGCCAGAGGATGGGTTAGCAGATGACAAGAAGCCATTCAAATGTTTCACTCCTAAAGGTTCATCTCTCAAGATAGAAGAGCGAGCAGAATTTTTGAACAAGTCTGTGCAGAAAAGTGGTGTCAAATCAACTCATCAGGCAGCAGTTGTCTCCAAGATTGACAGCAGACTGGAGCAATACACCAGCGCCATCGAGGGAACGAAAACCGCAAAACCTACAAAGCCAGCAGCCTCGGATCTTCCGGTTCCTGCCGAAGGTGTTCGCAACATGAAGAGCATGTGGGAGAAAGGGAATGTGTTCTCATCCCCCGCTGCGTCGGGCACGCCAAACAAGGAAACTGCTGGCTTGAAGGTGGGGGTTTCCAGCCGCATCAATGAATGGCTAACCAAAACCCCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCAGATTTGAGGCCAGGAGACGTATCTGGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGATAAGGTCACATCCCCCACTAAGGTCTGAGACAGTTGAAGAAAGAACCCCAGAGTAGCCACTCAAGATGCTGGACCAGCTCAGCTGAAGAGGGTTAATGTGCTCTGTTTTATATTTATGTTGATTTACTAAATTGGGTTCATTTCCTTTTGTTTTATTTTCCATTATCCCGGTAAACCTATGTATATTATCACCATATTTAATAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAACGAAACCCATGCTGTGAAATAGAGACTTTTCTACTGATCATCAGAACTGTGTGTGAACAGTGATACCAACCACATTGGAAGTCAAACAAAAGGAGATTCAAGTTGAAAATTGCCTGAGGAATGTGTGCAGTATCCAGAAAAATGAACCGTAGTGGGTTTTGGGTTTTTTTTTTAATTTTAAATACAAAAGTCATGTTGTTTCTGCACTTTAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTCTGAAACTAATTCATTTCAGATTTGAGATACTATAATGATGATTGTCTTTTTAAAAAAAATGTATTGTTAAGGTATTACTTTTTTCATGCTGATGAATATCTAAATCGGATAAGGATTTTAGCTGACAGGGGTACTGATTTATTTAGGTTGGTTGCTTTGTGGATTTCTTTGGTAGTGATAGTGAACCACATTTTAGATGACCTGATCATATATGTATGTGCATACACATATACAAACACACTAATGGTAGAAAGCTTTTTCATGTGCTAGACTATTGTATTTAGCAGTATGTCCTTGTAACTAGACAATATCACAGCTTTTTAAAAATTACAAATCACAATATTCTATTAATATTTCATATTTGCCAATGGAGACATGGCAGAATAGGTATCGATATGTTTTCGATGCCCGATAGATGACCTATAAGGAAAAAGAGAGATTAGAAATATCAAAATGTCAGTTTATAGAATCAACATTTTCTATGAAACATAATATTTAGCTTATAATTAAAGGCAATCTTGAAGGCCAATGTGAATTTTACTAAATCTACCATCTGGATCAAACTCAAAGCTTGCCCAAAACTTTATTCTGTTAATAAGCGAGTTCACAATAGGTTGGCCTAAATGATACCTGAGGTCTCTTCCTTTTTTCAAATTTAAAGACAAGAATTTTAGTGACAAGATTGTGCAGACTGAAATTCCATGGACAGGTATACAAAGACCAACTTTGGCTAATGTCTAGAAGCAGGGAAGAAAAGTAAGCAAAACCCACTGTTTAGAAGTCATGACAATACTTCCATCTTTAATATACTGAACCAATTTTTAAATTAAACTTTTCTACTTATATTATTAGTCATTGGTACTTATCATAAGTTGATAATGTGTCGAACTTTGAAGAAGTATATATAACTTTTATTAGTTTTATCTTTTTCCCCAAGAGTCTTCACCAACTCATCATTTTTACACAATCCAGATATCAGATCTTATTTTAGCTTATACGTGTCCATCTGTTCTTCCCAATAGATGATAAGAGTACTCCAGTGTCTTGGAAATATGTTCTAGCATAGAGATATATAGGGTAGTTCTATAAACTTATACCTCATTTGACTTAACCAAAATGGTCCTAGTCTCAATTCCTACCACAATGAGGGAACCTCCCAAATGACTCTTTTCTAGCTCTTTTTTGGAAGAGCTAGCCAGGGCAGTGCTGGCATGAAGAGTGACCACTGCCTGACAAAGTCTATCTTCCTCAAAAATTAGTAAAGAGTAATTGAATTCTCTAGCTTTTAGCGCACCTGGGACAAAGCAAGGAAAGCCGCCTAGACTGCACAAATCATCTGCCCAAGACAGAGTAGATATGAGTCTGTGATAAGATGAACTATAATCCACAAGTAGTGCCTGATTTAGCATTGACTCCCATCATTGGGATGAAACAGATCAAAGTTTGAATTAAGGCCCATGGCGATGTAACATTGCTTTGTTGTACTTTTGAACAAGAGCTTCGCCTGATCACTATTATATATGTTTTTCTAGAAAATCTAAAGTTGAGAAGAGAATATGTCGATCCTGACTTTTATTCCAATATTTGGATGGAATAAATTTTAGGGTAGAATTTTGTTTAGTTTGGATTTAATCTTTTGAAAAACAAATTCTTTGTTTACCTGTTTGATTACAACGCTCTTTGTTATCTTTAAGAGGTAAAGCTGCAAAGTGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATATTTGTCACTGATAATTGATCGCTGCAATAAATATGTATTGTGAAAAAGCATCCACAATAAATGGAATTCCTCC