Transcript asmbl_24596

Sequence
Transcript Sequence for observation asmbl_24596 of TGE0023927:
GGGAATAATCCCGGCGAAAATCGACATATGTGAGCTAGAGCAGATTTTCGAATCGTTGTACGCCTGGGTCGGTCGAGCGTGCAGTTCGGAGGGGATAGCGTGGTACCTTTCTGTTCAGGTGTCGCCCCGGGCAGCCTCACCCTTTTCTGGGGTTTCCGTGCGGCACAGGGCTCCGTTGGTGCGCATCCAAGATGGCGACGCTGTTGGCGGTAAATTCGGCTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGA