Transcript asmbl_24594

Sequence
Transcript Sequence for observation asmbl_24594 of TGE0023925:
CTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGATGGTGAAGGAGGAGTAGAAGATGAAAATAGGTCTGTCTCTGGATTCCTTCACTTTGACACTGCCACAAAAGTGCGTCGAAAAATTCTGAGTATTCTTGACTCAATTGACTTTAGTCAGGAGATACCCGAGCCTTTGCAGTTGGATTTCTTTGATCGGACTCAGATTGAACAAGTTATTGCTAACTGTGAACATAAGAATTTACGGGGACAGACAGTCTGCAATGTCAAGCTTCTTCATAGGGTTCTTGTAGCCGAAGTTAATGCCCTTCAGGGTATGGCAGCCATAGGACAGAGACCTCTACTGATGGAGGAAATCAGCACTATACTTCAGTATGTGGTAGGAAGAAACAAATTGTTGCAGTGTCTTCATGCAAAACGGCACGCGCTGGAGTCATGGCGGCAGCTGGTAGAAATTATACTGACAGCTTGTCCCCAGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGA