Transcript asmbl_24593

Sequence
Transcript Sequence for observation asmbl_24593 of TGE0023924:
GGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGCGCCAGTGCTTAGGACTACTAAGTCGCTTTGGTGGCTCGGACAGACTCCGTCAGTTTAAATTTCAAGATGATAATGTGGAAGGAGATAGAGTGAGCAAGAAAGACGAGATTGAACTGGCTATGCAACAGATTTGTGCCAATGTCATGGAATATTGCCAGTCGCTCATGTTACAGAGTTCCCCTACCTTTCTGCATGCCGTGTGTCTCTTCACCCCAAGCCTGTCAGAAACCGTTAACAGAGATGGGCCCCGGCAAGATACCCAAGCTCCAGTAGTTCCGTATTGGCGCCTGCCTGGTTTGGGCATTATTGTCTACCTGCTGAAACAGAGCGCTAGTGATTTCTTCAGCTATTATGACAGTCACCGACGGAGTGTCAACAAGCTACAGAATGTAGAGCAGCTTCCACCAGATGAGATAAAAGAGTTATGTCAGTCTGTGATGCCTGCTGGTGTTGATAAAATCTCCACCACCCAGAAATATGTTCTAGCAAGACGGCGTTTGGTGAAGCTGATCAACAATCGAGCCAAACTGCTTTCCCTTTGTTCTTTCATCATAGAGACCTGCCTCTTTATCCTCTGGCGCCATCTGGAGTACTACCTGTTACATTGCACGCCCACAGATTCGCAAGATTCCTTGTTCGCCTCCAGGACCTTGTTTAAAAGCAGAAGGCTACAAGATTCCTTAGCTTCAGAAGCCAATCTAGATTTTAGAAGTGGACTGACTATAGTGAGCCAACATGACATAGACCAGCTCCAGGCCGACGCTATCAACGCCTTCGGAGAATCACTGCAAAAGAAACTTCTGGACATTGAAGGATTATATTCAAAAGTTCGATCTCGCTATAGTTTCATACAAGCTCTTGTCAGACGTATCCGAGGCTTACTGAGGATATCACGGAACTGAGCTCTTCTAGGGAAGAGATGAATTGGAAAACTGTCTCCTTTTTATAGATTAGTTTGTCTTTAAATTATGACCAAAAAATATTTTGCTATTTCTTTCTTTATATATGGACATCTTTTCTGTAAACTTCTTTGCCTGGTTTCATCCTCATTAGTAAAAAA