Transcript asmbl_24573

Sequence
Transcript Sequence for observation asmbl_24573 of TGE0004254:
CTGGAACAAAGGTGCCATATGCTGCGGTTCCTGTAACGACAGACGATCAGCTGCCATCTGTCTTCTGGAGGTCACCCCTCTAGGGTCTCTGGGGAACAATGGGAGTCTTGGGCTTCCTCACACTGGAAGCGAACGGCCCCATGCTGACAGTGGCCCTGTCTGTGGTCCTCTTGGCTCTCCTGAAATGGTACTCTACGTCAGCCTTTTCAAGACTGGAGAAGTTGGGCATCAGACATCCCAAGCCTTGTCCTTTTATTGGAAACTTGACATTTTTCCGCCAGGGCTTCTGGGAAAGTCAGATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGCCGTCGGATGTTTATCGTTATCTCCAAACCGGACATGATCAAGCAGGTGTTGGTCGAGAACTTCAGTAACTTTACCAACAGAATGGCATCGGGTTTGGAATCCAAACCGGTAGCAGACAGCGTGCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAAGTGTTCTAACTTCTGCTTTCAGTCCTGAGAAGCTGCATGAGATGATTCCTCTAATCAACCAAGCCTGCGACCTTCTCCTGACTCATTTAAAACACGATGCGGAACGTGGAGACGCTGTCGACATCCAGAGGTGCTACAGCTGCTACAGCACAGATGTGGTGGCCAGTGTCGCCTTCGGCACCCAGGTGGACTCCCGAAAGGCTCCTGAGGACCCCTTTGTCAAGTACTGCAGGCGTTTCTTTGCCTTCGGCATCCCCAGACCTCTCCTGGTTTTCATCGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTTTGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGATTGCCTTGCGGGACCAGCAAGCAGCAGAAGAGAGGCGGAGAGACTTCCTCCAAATGGTCCTGGATGCCCGACAATCCACCCCTTCCGTGGGCGTGGAGAGCTTCGACATAGTCAGACAAGTCTTCTCATCCTCCGAATGCTCAGCGAATCCTTCCCAGCAAGGCCAGCCCAGACCCCTGTCCAAGCCCTTGACTGTGGATGAGATCGTGGGCCAGGCCTTCCTCTTCCTCATCGCCGGCTACGAGATCATCACCAACACACTATCTTTCGCCACCTACCTACTGGCCACCAACCCTGACTGCCAAGAGAAGCTTCTGACAGAGGTGGACCGTTTCAACGAGAAATATGCGACCCCCGAGCTCTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCGCAGAGACCTTGAGGATGTACCCGCCAGCTTTCAGGTTCACGCGGGAGGCGGCAAAGGACTGCGAAGTGCTGGGGCAGCGCATCCCCGCCGGCACCGTGGTGGAGATGGCCGTGGGCGCCCTGCACCGCGACCCGGAGCACTGGCCCCGCCCCGAGGCCTTCGACCCGGAGAGGTTCACGGCGGAGGCCCAGCGGCGCCGGCGGCCCTTCACCTACCTGCCATTTGGAGCGGGGCCCCGGAGCTGCCTCGGCGTGAGGCTGGGGCTGCTGGAGGTCAAGCTGACGCTGCTCCACGTCTTCCGGAAGTTCCGGTTCAAAGTCTGCCCCGAGACTCAGGTGCCACTGCAGCTAGAATCCAAATCTGCCCTAGGTCCGAAAAATGGTGTCTACATCAAGATTGTCTCCCGCTGACAGTTAAGAGGGCACCCCCTAATTCGAGGAAAACTTTCATGTGGAAATTCAGATATTTGGGGAGACATCACCTTAGCCATTGAAAGGGTGTCTGGAATGCAAGTATACAAGAAGTCATTTACATAACATGTCCTAAATGCTTAATAAATGTTTGCTGCACTTA